The APICULTURAL SOCIETY OF KOREA
1

Current Issue

Journal of Apiculture - Vol. 32 , No. 1

[ Original Article ]
Journal of Apiculture - Vol. 32, No. 1, pp.27-39
ISSN: 1225-0252 (Print)
Print publication date 30 Apr 2017
Received 30 Nov 2016 Revised 30 Mar 2017 Accepted 05 Apr 2017
DOI: https://doi.org/10.17519/apiculture.2017.04.32.1.27

꿀벌 6종 주요 병원체에 대한 초고속 다중 PCR 검출법의 개발
임수진 ; 김정민 ; 이칠우1 ; 윤병수*
경기대학교 자연과학대학 생명과학과
1한국꿀벌질병연구소

Development of Ultra-Rapid Multiplex PCR Detection against 6 Major Pathogens in Honeybee
Su-Jin Lim ; Jung-Min Kim ; Chil-Woo Lee1 ; Byoung-Su Yoon*
Department of Life Science, College of Natural Science, Kyonggi University, Suwon 16227, Korea
1Korea Honey Bee Disease Institute, Suwon 16227, Korea
Correspondence to : *E-mail: bsyoon@kyonggi.ac.kr

Funding Information ▼

Abstract

PCR-chip-based ultra-rapid multiplex PCRs for detection of six major infectious pathogens in honeybee were developed. The 6 kinds of major infectious pathogens in honeybee included Paenibacillus larvae causing American Foulbrood, Melissococcus plutonius causing European Foulbrood as bacteria, Ascosphaera apis (Chalkbrood), Aspergillus flavus (Stonebrood), Nosema apis and Nosema ceranae (Nosemosis) as fungi. The developed PCR-chip-based ultra-rapid multiplex PCR showed successful amplification for all six major pathogens in the presence of more than 103 molecules. The time for confirming amplification (Threshold cycles; Ct-time) was about 7 minutes for two species, and about 9 minutes for four species. Total 40 cycles of PCR took 11 minutes 42 seconds and time for melting point analysis was 1 minute 15 seconds. Total time for whole PCR detection was estimated 12 minutes 57 seconds (40 cycles of PCR and melting point analysis). PCR-chip based ultra-rapid multiplex PCR using standard DNA substrates showed close to 100% accuracy and no false-amplification was found with honeybee genomic DNA. Ultra-rapid multiplex PCR is expected to be a fast and efficient pathogen detection method not only in the laboratory but also in the apiary field.


Keywords: Ultra-rapid multi-PCR, 6 honeybee diseases, Ultra-rapid, PCR-chip, Honeybee

서 론

꿀벌은 수만의 개체가 제한적 공간에 밀집하여 생활한다는 특성을 가지며, 그만큼 각종 전염병에 노출될 가능성이 매우 높다. 현재까지 알려진 꿀벌의 질병 중 국내 양봉에 큰 영향을 미친 세균성 또는 진균성 질병의 주요 병원체들은 미국부저병(American Foulbrood, AFB)의 Paenibacillus larvae와 유럽부저병(European Foulbrood, EFB)의 Melissococcus plutonius, 백묵병(Chalkbrood, CB)의 Ascosphaera apis, 석고병(Stonebrood, SB)의 Aspergillus flavus, 그리고 노제마병(Nosemosis)의 원인균인 Nosema apisNosema ceranae가있다.

유 등(2009)의 국내 꿀벌 질병 발생 빈도에 대한 조사에서, 2009년 국내에서 수집된 꿀벌의 질병 시료 중 58.8%가 미국부저병에 감염되어 있었으며, 노제마병 42.9%, 석고병 24.9%, 백묵병 12.9%의 순으로 나타났다. 또한 농림축산검역본부의 2015년도 꿀벌질병 발생 현황은 석고병 66.5%, 노제마병 23.3%, 유럽부저병 15.5%, 백묵병 10.6%, 미국부저병 4.6%으로 나타났으며, 이는 접수된 꿀벌 질병시료에서 P. larvae, M. plutonius,Ascosphaera apis, Aspergillus flavus, 그리고 Nosema apisNosema ceranae들은 주요 세균성 및 진균성 병원체로 파악되고 있다. 또한 이들 질병은 국내 뿐 아니라 국외에서도 발병률과 재 발병률의 조사에서 주요 문제로 언급되고 있으며(Roetschi et al., 2008; Wilkins et al., 2007), 특히 Nosema ceranae의 경우 2016년 뉴질랜드에서 처음으로 그 존재가 새로이 발견되기도 하였다(Frazer et al., 2016).

한편, 꿀벌 병원체에 대한 유전자 검사법은 주로 개별 병원체 진단을 목적으로 개발되어 왔으며, 이는 특이 유전자의 검출과 검량에 집중되어 왔다. 꿀벌 특정 병원체에 대한 일반 PCR 검출법(Van Nguyen et al., 2010; 유 등, 2007; 강 등, 2008), 병원체의 정량적 검출을 목적으로 하는 정량 PCR법(유 등, 2008a; 유 등, 2008b; 유 등, 2010), 짧은 시간 내 병원체의 빠른 검출을 위한 초고속 PCR법(Yoo et al., 2011; Lim and Yoon, 2013; Luong et al., 2015), 그리고 현장 적용성을 강화한 현장 초신속 검사법(Ultra-fast PCR; UF-PCR)과 고리매개 등온 증폭법(Loop-mediated isothermal amplification; LAMP)이 꿀벌 질병 진단법으로 개발되어 왔다(Lim, 2013; Lee et al., 2016; 왕 등, 2016a). 하지만 이러한 검출법들은 개별 혹은 2개 병원체에 대한 PCR 검사와 진단에 초점이 맞추어져 있으며, 다양한 병원체에 대한 일련의 검색을 위하여 특이 PCR 검사들을 각각 수행 하여야 하는 불편함을 가지고 있다.

따라서 본 연구에서는 꿀벌 병원체 개개에 대한 개별 진단의 한계를 넘어, 6종의 주요 세균성 또는 진균성 꿀벌 병원체에 대하여 종합적 정성/정량 검사가 가능한 PCR-chip을 디자인 하였으며, 제작된 PCRchip을 기반으로 진단 시간을 최소화한 초고속 동시 진단법을 개발하고자 하였다. 이는 실험실 검사와 현장 검사의 상황에서 초고속 동시 진단이 가능한 ultrarapid real-time PCR system을 사용하였으며, 목적 유전자 산물의 증폭 시작점을 실시간으로 인지하고 증폭 유무를 melting temperature (Tm)를 통해 판단할 수 있게 하였다. 이로써 꿀벌의 주요 6종 병원체의 특이 유전자 검사를 하나의 PCR-chip을 이용하여 동시에 수행할 수 있는 초고속 진단법을 개발하고자 하였다.


재료 및 방법
시료 수집과 꿀벌 성봉 및 유충의 핵산 순수 분리

꿀벌 유충 시료는 2016년 7월 경기대 양봉장에서 질병에 감염되지 않은 건강한 시료를 채집하여 사용하였다. 채집한 유충 시료는 -70°C에서 냉동보관 하였으며, 핵산의 분리는 Patho Gene-spinTM DNA, RNA extraction kit (iNtRON Co., Ltd, Korea)를 사용하여 DNA를 순수분리 하였다. 분리한 핵산은 Biophotometer (Eppendorf Co., Ltd, Germany)를 사용하여 정량한 후, -70°C에 보관하며 실험에 사용하였다.

꿀벌 병원체의 특이 유전자와 꿀벌 housekeeping 유전자

사용한 꿀벌과 꿀벌 병원체 특이 유전자 재조합 DNA들은, 경기대학교 생명과학과 분자생물학 실험실에 확보된 것으로, 각 재조합 DNA들을 각 병원체의 유전자 정보들과 비교하여 각각 특이 염기서열이 존재함을 확인하였으며, 각각의 유전자 정보 및 참고문헌은 Table 1과 같다.

Table 1. 
The recombinant DNAs of 6 honeybee pathogens and β-actin gene
Pathogens/gene Diseases GenBank accession No. Gene information Reference
Paenibacillus larvae American Foulbrood U85263 16S rRNA 왕 등, 2016b
Melissococcus plutonius European Foulbrood X75751 16S rRNA 하 등, 2005
Melissococcus plutonius European Foulbrood AP012200 DNA gyrase subunit B Van Nguyen et al., 2012
Ascosphaera apis Chalkbood M83264 18S rRNA 이 등, 2004
Aspergillus flavus Stonebrood D63696 18S rRNA Lee et al., 2015
Nosema apis Nosemosis U97150 16S rRNA Lim et al., 2014
Nosema ceranae Nosemosis DQ486027 16S rRNA 왕 등, 2016b
β-actin Housekeeping gene AB023025 mRNA Unpublished

6종 꿀벌 질병 진단을 위한 PCR-chip용 프라이머

6종의 꿀벌 병원체 진단을 위해 16S rRNA (P. larvae, M. plutonius,N. apis, N. ceranae), DNA gyrase subunit B (M. plutonius), 18S rRNA (A. apisA. flavus)의 특이 염기서열에서 ultra-rapid multi-PCR (UR-multi-PCR)용 프라이머 쌍을 선정하였으며, 꿀벌 핵산의 유무와 PCR 반응의 판별을 위한 대조군으로 사용하기 위하여 housekeeping 유전자인 β-actin 프라이머 쌍을 설계하였다(Table 2). 또한 본 프라이머 쌍들은 Table 1의 재조합 DNA의 특이 염기서열에 근거하여 설계하였으며, 프라이머의 합성은 Bionics사(Korea)에 의뢰 합성하였다.

Table 2. 
Primer sets of 6 honeybee pathogens and β-actin primer set for UR-multi-PCR
타이틀1 타이틀2 타이틀3
Paenibacillus larvae AFB-DC-F1 ATCGTAAAGCTCTGTTGCCAAGGA 왕 등, 2016b
(16S rRNA) AFB-DC-R1 TCCTCTCCTACACTCAAGTCTCC
Melissococcus plutonius EFB-DC-F1 AAGAGTAACTGTTTTCCTCG 왕 등, 2016b
(16S rRNA) EFB-DC-R1 TCCTCTTCTGCACTCAAGTCTTC
Melissococcus plutonius EFB-PC-F1 GCGAATGAAGAAATTCGTTCA This study
(DNA gyrase subunit B) EFB-PC-R3 GTTGGGCAATATAAACATACCCA
Ascosphaera apis AA-DC-F1 ATCGGGCGGGCTTTAACTA 왕 등, 2016b
(18S rRNA) AA-DC-R1 TCTGGACCTGGTGAGTTTCC
Aspergillus flavus AF-DC-F1 GAACGAGACCTCGGCCCTT 왕 등, 2016b
(18S rRNA) AF-DC-R1 GGGTTTAACAAGATTACCCGGACC
Nosema apis NoA-F3 (179) TAACAATGTAGTCGTTATTAGC This study
(16S rRNA) No-R2 TACCACACAGTTCGATTGGTC Lim et al., 2014
Nosema ceranae No-DC-F2 GGTAATGGCTTAACAAGGCTGTGA 왕 등, 2016b
(16S rRNA) No-DC-R1 CCTCATATTGCTTCTTAAAAAAATAAAC
Honey bee β-actin151-F ATGCCAACACTGTCCTTTCTGG Yang and Cox-Foster 2005
(β-actin) β-actin151-R GACCCACCAATCCATACGGA

6종 병원체 프라이머 쌍에 대한 목적 유전자의 검출 한계

각 꿀벌 병원체의 특이 유전자 재조합 DNA 주형(Table 1)을 106 copies에서 100 copies DNA까지 연속 희석하여 초기 주형량에 따른 검출 한계를 확인하였다. Multi-PCR은 GENECHECKER (GENESYSTEM Co., Ltd, Korea)에서 Rapi:Chip (GENESYSTEM Co., Ltd, Korea)을 사용하여 수행하였으며(왕 등, 2016a), 각 well은 5μl의 2×Rapi mix (GENESYSTEM Co., Ltd, Korea)와 1μl씩의 각각의 forward와 reverse 병원체 특이 프라이머 쌍(각 최종 농도 1μM)과 1μl의 연속 희석한 재조합 DNA로 총 10μl PCR 반응액으로 조성하였다. Multi-PCR 반응은 95°C 초기 변성 30초, 95°C 변성 4초, 52°C 중합 4초, 72°C 신장 4초로, 총 40회전 또는 50회전 수행하였다.

질병 진단을 위한 최적 꿀벌 핵산 사용 범위의 확립

진단에 적합한 꿀벌 애벌레의 핵산 사용량을 확립하기 위하여, 꿀벌 애벌레에서 추출한 핵산을 주형으로 β-actin 유전자의 증폭량을 확인하였다. PCR 반응은 5μl의 2×Rapi mix와 1μl씩의 β-actin 151-F(최종 농도 1μM)와 β-actin 151-R(최종 농도 1μM) 프라이머에 꿀벌 애벌레의 핵산(최고 1μg에서 최저 1ng까지 희석), 총 10μl로 조성하여 수행했으며, 이때의 positive control로써 1.48×105 copies의 β-actin 유전자를 포함하는 재조합 DNA를 사용하여 β-actin PCR 산물의 합성 유무와 특이 Tm값을 비교하였다. Multi-PCR 반응은 95°C 초기변성 30초, 95°C 변성 4초, 52°C 중합 4초, 72°C 신장 4초로, 총 40회전 수행하였다.

꿀벌 genomic DNA 존재 시 6종 병원체 프라이머 쌍에 대한 목적 유전자의 검출 한계

12종 병원체(Black queen cell virus, Chronic bee paralysis virus, Deformed wing virus, Israeli acute paralysis virus, Sacbrood virus, Korean sacbrood virus, Paenibacillus larvae, Melissococcus plutonius, Ascosphaera apis, Aspergillus flavus, Nosema apis, Nosema ceranae)의 존재를 확인한 실시간 PCR의 결과에서 어떠한 병원체도 검출되지 않은 꿀벌 애벌레의 핵산 50ng과 6종 병원체의 각각의 재조합 DNA 주형을 106 copies에서 100 copies DNA까지 연속 희석 하여, 각 well당 5μl의 2×Rapi mix와 1μl씩의 각각의 forward 와 reverse 병원체 특이 프라이머 쌍과 총 10μl PCR 반응액으로 조성하였다. Multi-PCR 반응은 95°C 초기변성 30초, 95°C 변성 4초, 52°C 중합 4초, 72°C 신장 4초로, 총 40회전 수행하였다.

6종 질병 초고속 진단을 위한 최적 프라이머 농도

각 질병의 진단 민감도를 높이기 위한 최적 프라이머 농도를 확립하기 위하여, 각 병원체에 해당하는 프라이머는 최종 농도를 4μM, 3μM, 2μM, 1μM, 500nM, 250nM로 조절하여 multi-PCR을 진행하였다. 각 well당 총 10μl로 조성하였으며 꿀벌 애벌레의 핵산 50ng에 각 병원체의 특이 재조합 DNA를 1×105 copies로 하여 5μl의 2×Rapi mix와 위의 각기 다른 프라이머 쌍의 농도로 multi-PCR 반응을 수행하였다. Multi-PCR 반응은 95°C 초기변성 15초, 95°C 변성 4초, 52°C 중합 4초, 72°C 신장 4초로, 총 40회전 수행하였다.

6종 질병 초고속 진단을 위한 최적 혼성 온도

UR multi-PCR에서 각 병원체 민감도를 높이기 위한 최적 혼성 온도의 확립을 위하여, 52~ 66°C 범위에서 측정되는 Ct값을 온도별로 비교 분석하였다. 각 well당 총 10μl로 조성하였으며 꿀벌 애벌레의 핵산 50ng에 각 병원체의 특이 재조합 DNA 105 분자와 각각의 병원체의 최적의 forward 와 reverse 특이 프라이머 농도를 적용하여 multi-PCR을 95°C 초기변성 15초, 95°C 변성 4초, 52~66°C 중합 4초, 72°C 신장 4초로, 총 40회전 조건으로 수행하였다.

꿀벌 6종 질병 초고속 다중 PCR의 최소 검출 시간 및 검출 한계 확립

6종 꿀벌 질병의 최적 및 최소 검출 시간을 확립하기 위하여, UR multi-PCR의 각 단계에서 초기변성은 95°C에서 15초로, PCR step 중 변성시간은 1초로 설정하였으며, 중합은 앞선 실험의 최적의 온도 조건에서 서로 다른 시간조건 3초, 2초 또는 1초로 하였고, 신장은 72°C, 3초로 설정하여 40회전으로 진행하였다. 사용된 PCR 조성은 총 반응액 10μl에 5μl의 2×Rapi mix와 각 병원체별 최적 농도의 프라이머를 첨가하였으며, 꿀벌 애벌레의 핵산 50ng과 재조합 DNA 105~103 copies를 사용하였으며, 이때 사용한 각각의 재조합 DNA 분자는 최소 검출 시간 내에 병원체의 검출 한계를 조사하기 위함이었다.

꿀벌 성체를 이용한 초고속 다중 PCR의 유효성 평가

UR multi-PCR을 통한 6종 꿀벌 병원체의 현장 적용실험을 평가하기 위하여, 경기대 양봉장에서 채집된 감염 시료로써, Aspergillus flavusNosema ceranae에 감염된 성봉에서 각기 핵산을 추출하여 PCR을 진행하였다. Patho Gene-spinTM DNA, RNA extraction kit를 이용하여 꿀벌 한 마리로부터 핵산을 추출해 내었으며, 각각 꿀벌 병원체 검사를 위한 multi-PCR은 well당 총 반응액 10μl로 하여 50ng의 꿀벌 핵산이 사용되었으며, 2×Rapi mix와 각 병원체별 최적화된 프라이머 농도로 조성하여, 최소 검출시간 조건에 따라 진행하였다.


결과 및 고찰
6종 병원체 프라이머 쌍에 대한 목적 유전자의 검출 한계

초고속중합효소연쇄반응(UR-PCR)에서 6종 꿀벌 병원체 프라이머 쌍에 따른 목적 유전자의 검출 한계를 측정하기 위해, 각 병원체에 해당하는 재조합 DNA를 약 1×106에서 1×100 분자까지 연속 희석하여 이를 주형으로 하였다. Paenibacillus larvae 16S rRNA 유전자를 포함하는 재조합 DNA 주형의 경우, AFB-DC-F1/R1 프라이머는 최소 1.23×103 분자까지 검출 가능함을 확인하였고(Fig. 1A), 검출산물의 융점분석에서 특이 Tm (melting Temperature) 값은 88.68±0.35으로 비특이 Tm값과 극명한 차이를 보였으며, 특이Tm값은 이들 검출산물의 유의성을 판별하는 기준이 되었다(Fig. 1B). 또한 다른 꿀벌 병원체의 특이 유전자(Mellisococcus plutonius 16S, Mellisococcus plutonius DNA gyrase, Ascosphaera apis 18S, Aspergillus flavus 18S, Nosema ceranae 16S와 Nosema apis 16S rRNA)와 꿀벌의 housekeeping 유전자(β-actin)가 포함되어 있는 재조합 DNA를 사용한 중합효소 연쇄반응에서 각 프라이머 쌍에 대한 검출 한계는 각각 1.24×101, 1.35×102, 1.17×103, 1.06×103, 1.03×102, 1.36×103, 1.48×101 분자였으며(Fig. 2A), 또한 목적 유전자 산물의 특정 Tm값을 통해 증폭의 유의성을 확인하였다(Fig. 2B).


Fig. 1. 
Specificity of PCR product according to initial templates of target gene for . Target gene of was amplified with AFB-DC-F1/R1 primer pair. Panel A is the fluorescent graph of amplified target gene according to the serially diluted initial templates. Panel B is a peak graph of Tm value. The PCR condition was 95°C, 30 sec of pre-denaturation, 95°C, 4 sec of denaturation, 52°C, 4 sec of annealing, 72°C, 4 sec of polymerization in each cycle for 50 cycles. AFB-DC-F1/R1 primers can detect 1.23 ×10 copies of recombinant plasmid inserted with 16S rRNA.


Fig. 2. 
Ct value and detection limit according to initial templates of target gene. Panel A showed the Ct value of each pathogens according to the initial templates and positive amplifications were classified with considering the Tm values of them (gy: DNA gyrase). Panel B revealed the detection limit of each primer pairs and range of positive Tm values of each pathogen.

질병 진단을 위한 최적 꿀벌 핵산 사용 범위의 확립

병원체 감염 시료의 초기 총 핵산을 최소화하는 것은 시료로부터 병원체 특이 유전자를 검출해 내는데 있어 불리하며 또한 과도한 핵산의 존재 역시 중합효소 연쇄반응에 영향을 주기 때문에 진단에 적합한 꿀벌 핵산의 범위를 정하는 것은 중요하다. UR-PCR에 적합한 꿀벌 핵산 사용 범위의 확립을 위해, 게놈 DNA (genomic DNA, gDNA)는 꿀벌 애벌레 한 마리(평균 73mg)로부터 평균 1.59μg을 추출하였고, 추출한 핵산은 꿀벌의 housekeeping 유전자인 β-actin 유전자의 검출을 위해 각각 1,000ng, 500ng, 250ng, 100ng, 50ng, 25ng, 10ng, 1ng을 반응에 사용하였다. β-actin 유전자 증폭 형광 그래프 상에서 정규 곡선을 형성하며, 초기 형광 강도의 2배 이상의 최종 형광 값을 갖는 핵산 농도는 100ng, 50ng, 25ng과 10ng이었으며, 25ng의 gDNA를 주형으로 하였을 때 가장 높은 최종 형광 값을, 1,000ng과 500ng에서는 가장 낮은 형광 값을 나타내었다(Fig. 3A). 꿀벌 핵산 농도별 β-actin의 Tm값은 앞선 실험의 81.79±0.84 범위의 유의 값에 분포하였다(Fig. 3B). 또한 100~25ng의 주형에서 Ct값 24로써 가장 빠르게 측정되었으며, 이어서 10ng과 250ng에서 Ct값 25, 1,000ng과 500ng에서는 Ct값이 측정되지 않았다(Table 3). 이는 과량의 핵산(1,000ng과 500ng)을 사용할 경우 목적 유전자의 증폭 유무를 판단하기에 부적합함을 보여 주었다. 따라서 과량의 핵산에 의한 영향이 없으며, 병원체 유전자를 포함하는 최대의 핵산을 사용하기 위하여, 형광그래프 상에서 관측되는 정규 곡선, 최종 형광 값, 그리고 측정된 Ct값을 토대로, PCR 증폭에 최적인 꿀벌 핵산 사용량은 50ng으로 판정하였다.


Fig. 3. 
The optimal condition of honey bee nucleic acid to UR-PCR. The amplification of β-actin gene was performed using 1,000-1ng gDNA of honeybee larvae. Panel A is the fluorescent graph of amplification according to initial gDNA and Panel B is peak graph of Tm value. The amplification of β-actin gene with 1,000ng and 500ng initial gDNA was done poorly. Only in 100-10ng gDNA as a template, the amplification curve was formed regularly and the optimal usage of gDNA was 50ng.

Table 3. 
The Ct value and Tm value of β-actin gene depending on the concentration of initial templates
Amount of genomic DNA 1,000ng 500ng 250ng 100ng 50ng 25ng 10ng 1ng
Ct value 0 0 25 24 24 24 25 29
Tm value 82.07 82.43 82.07 82.07 81.71 81.71 81.36 82.07

꿀벌 gDNA 존재 시 6종 병원체 프라이머 쌍에 대한 목적 유전자의 검출 한계

꿀벌의 gDNA내의 각 병원체 DNA가 함께 존재할 경우 검출 한계를 확인하고자, 각 병원체에 해당하는 재조합 DNA를 1×108에서 1×100 분자까지 연속 희석하여 50ng의 꿀벌 gDNA와 혼합하여 이를 각각의 UR-PCR에 사용하였다. Paenibacillus larvae 16S rRNA 특이 프라이머쌍은 꿀벌 gDNA 존재 하에서 최소 1.23×103 분자까지 검출 가능하였으며(Fig. 4A), 이때 특이적인 증폭에 대하여 Tm은 88.95±0.35로 확인되었다(Fig. 4B). 이외에 Mellisococcus plutonius 16S, Mellisococcus plutonius DNA gyrase, Ascosphaera apis 18S, Aspergillus flavus 18S, Nosema ceranae 16S와 Nosema apis 16S rRNA의 검색에 대하여 각각 1.24×103, 1.35×102, 1.17×102, 1.06×103, 1.03×102, 1.36×103의 분자까지 검출이 가능하였으며, 이때 각 Tm값의 범위는 87.16±0.35, 80.29±0.50, 87.31±0.42, 89.57±0.36, 81.80±0.65, 78.96±1.26으로 나타났으며, 이는 실전시료에서의 각 병원체별 유전자 증폭 유무를 판단하는 특이 지표로써 사용이 가능할 것이다 (Fig. 5B).


Fig. 4. 
Specificity of PCR product according to initial templates of target gene for mixed with honey bee gDNA. The target gene of was amplified with AFB-DC-F1/R1 primer pair. Panel A is the fluorescent graph of amplified target gene of according to the serially diluted initial templates. Panel B is a peak graph of Tm value. The PCR condition was 95°C, 30 sec of pre-denaturation, 95°C, 4 sec of denaturation, 52°C, 4 sec of annealing, 72°C, 4 sec of polymerization in each cycle for 40 cycles. AFB-DC-F1/R1 primers (Final conc. 1uM) can detect 1.23×10 copies of recombinant plasmid inserted with gene with 50 ng genomic DNA of honeybee.


Fig. 5. 
Ct value and detection limit according to initial templates of target gene mixed with honeybee gDNA. Panel A showed the Ct value of each pathogens according to the initial templates with gDNA and positive amplifications were classified with considering the Tm values of them (gy: DNA gyrase). Panel B revealed the detection limit of each primer pairs and range of positive Tm values of each pathogen.

애벌레 한 마리당 회수한 gDNA는 평균 1.59μg에 해당하였고, 50ng의 genomic DNA 존재 하에 Paenibacillus larvae의 16S rRNA 재조합 유전자는 1.23×103의 분자까지 검출할 수 있었으므로 이를 역으로 계산(1.59μg / 50ng) × detection limit of each pathogen)하였을 때, 1.59μg에 해당하는 애벌레 한 마리에 3.91×104 copies 이상의 병원체가 있을 경우 검출이 가능한 것으로 확인하였다. 나머지 유전자 역시 애벌레 당 회수한 평균 gDNA 1.59μg를 기준으로, Mellisococcus plutonius는 3.94×104, Mellisococcus plutonius (gyrase)는 4.29×103, Ascosphaera apis는 3.72×103, Aspergillus flavus는 3.37×104, Nosema ceranae는 3.28×103, Nesema apis는 각각 4.32×104 copies의 병원체가 존재할 경우 검출 가능한 것으로 산출하였다.

6종 질병 초고속 진단을 위한 최적 프라이머 농도

초고속 PCR에 적합한 6종 질병(7종의 유전자)와 β-actin 유전자 프라이머의 최적 농도를 확립하기 위하여 최종 농도 4μM, 3μM, 2μM, 1μM, 500nM과 250nM의 범위에서 UR-PCR반응을 진행하였다. 3회 반복 시행하여 각 농도별 측정되는 Ct값과 최종 형광 값, melting graph에서 비특이적인 그래프가 형성되지 않는 조건에서 최적 프라이머 농도를 설정하고자 하였다. 그 결과 AFB-DC-F1/R1, EFB-DC-F1/R1, EFB-PCF1/R1, AA-DC-F1/R1, AF-DC-F1/R1은 최종 농도 2μM을 사용하였을 때 민감도가 가장 우수하였으며, No-DC-F2/R1와 NoA-F3(179)/No-R2는 최종 농도 4μM을 사용하는 것이 검출에 가장 유리하였고 또한 β-actin 151-F/R는 최종 농도 1μM에서도 우수한 증폭을 보였다(Table 4).

Table 4. 
Ct and range of Tm value according to each concentration of 8 primer pairs
Final concentration P. larvae M. plutonius M. plutonius. (gyrase) A. apis A. flavus N. ceranae N. apis β-actin
250nM 32*(NS) 24*(NS) 28*(NS) 0 (NS) 28 0 (NS) 31 (NS) 26
500nM 30 29 25 39 28 0 (NS) 35 (NS) 22
1μM 26 25 25 34 25 33 32 20
2μM 25 25 21 34 23 29 29 19*(NS)
3μM 25 24 22 33*(NS) 24 (NS) 29 30 19*(NS)
4μM 24 24 17**(NS) 33**(NS) 22*(NS) 29 24 19**(NS)
Tm (°C) 88.21±0.58 86.93±0.32 80.29±0.25 86.84±0.48 89.10±0.29 81.45±0.17 78.41±0.34 81.94±0.33
NS: non-significant signal
*: non-specific signal and
**: Strong non-specific signal

6종 질병 초고속 진단을 위한 최적 중합 온도

UR-PCR을 지향함에 있어 높은 중합 온도는, PCR 단계 간의 온도 상승속도와 하강속도(Ramping time)를 줄여, 전체 반응 시간을 단축시킬 수 있는 중요 요소이다. 따라서 6종 질병(7종의 유전자)와 β-actin 유전자의 증폭이 모두 가능한 높은 중합 온도의 검색이 요구되었다. 이에 중합 온도를 52°C에서 66°C까지 각기 달리하여 UR-PCR을 수행하였으며, 이들 유전자의 검출이 가능한 온도를 확인한 결과, P. larvae 16S, A. flavus 18S와 β-actin gene은 66°C의 중합 온도 에서도 검출이 가능하였으며, 그 다음으로 M. plutonius 16S, A. apis 18S는 64°C 그리고 M. plutonius DNA gyrase, N. apis 16S는 62°C, N. ceranae 16S는 60°C의 중합 온도까지 증폭 가능하였다. 그리하여 본 실험에서 목적하는 UR-PCR 지향을 위해, 각각의 다른 8개 유전자의 검출이 용이한 높은 중합 온도의 설정은 동일분자 수(105 copies)에서의 Ct값 분포를 고려하여 60°C로 설정하였다(Fig. 6).


Fig. 6. 
The optimal annealing temperature of 6 species pathogens and β-actin gene. For confirming the optimal annealing temperature of UR multi-PCR, the annealing temperature was controlled at 52°C to 66°C , , β-actin gene can be detected up to 66°C annealing temperature and , gene can be detected up to 64°C (gy: DNA gyrase), can be detected up to 62°C annealing temperature and can be detected up to 60°C annealing temperature. As a result, the optimal annealing temperature was 60°C (). 10 copies of DNA were used as template and the concentration of each primer pairs was based on optimal condition.

꿀벌 6종 질병 초고속 다중 PCR의 최소 검출 시간 및 검출 한계 확립

UR multi-PCR 최소 검출 시간 확립을 위하여, 앞서 확립한 각 프라이머 쌍의 최적 농도와 최적 중합 온도 60°C를 기반으로 하였으며, 각 PCR 단계의 반응시간을 조절함으로써 병원체 최소 검출 시간을 확립 하고자 하였다. 중합 온도를 제외하고, 변성 90~95°C, 신장 70~72°C 사이에서 조절하여 40회전 반응하였으나, 변성과 신장의 온도는 기본 조건인 95°C 이하, 72°C 이하로 조절하였을 때 증폭에 불리함을 확인하였다. 또한 초기 변성은 15초 미만일 때 PCR 효율이 감소함을 확인하였다(자료 미제시). 변성과 중합 단계의 반응시간을 각 1초로 단축하여도 목적 유전자의 증폭에는 큰 변화가 없음이 확인되어, 초기변성 95°C, 15초, 변성 95°C, 1초, 중합 60°C 1초, 신장 72°C로 PCR 조건을 확립하였다. 최종적으로 신장 시간을 1~3초로 하여 꿀벌 애벌레의 핵산 50ng과 각 재조합 DNA 105 copies를 주형으로 PCR을 수행한 결과, 6종의 병원체 유전자의 증폭은 신장 3초에서 검출에 가장 유리한 형광 값 및 Ct 값의 분포를 보였다 (Fig. 7A). 또한 각각의 병원체 유전자의 PCR 산물은 특이 Tm값을 나타냈으며(Fig. 7B), UR multi-PCR의 형광창과 아가로스 전기영동에서도 특이 산물이 합성됨을 확인하였다(Fig. 7C). 이 때 6종 질병(7종의 유전자)에 대하여 검출이 가능한 UR-multi PCR의 최소 검출시간(Ramping time 포함)은 12분 57초였다.


Fig. 7. 
Minimum running time for detecting 6 honeybee diseases and β-actin gene. In order to confirm the minimum detection time which can amplify seven kinds of gene and β-actin gene, the polymerization time was controlled from 1 sec to 3 sec. Template DNAs were 10 copies of recombinant DNA. PCR condition was 95°C, 15 sec of pre-denaturation, 95°C, 1 sec of denaturation, 60°C, 1 sec of annealing, 72°C of polymerization in each cycle for 40 cycles. The time of polymerization which can amplify all 8 genes was 3 sec. Accordingly, the total running time of UR multi-PCR was 12 min 57 sec. Panel A is the fluorescent graph of amplification and panel B is peak graph of Tm value of each pathogen. Panel C is a fluorescence panel in window (upper) and agarose gel electrophoresis (below) of amplified DNA.

더 나아가 각각의 6종의 질병(7종의 유전자)에대한 UR multi-PCR의 최소 검출시간(Ramping time 포함)은 12분 57초에서 검출 한계는 103 copies까지 검출 가능하였다(Table 5). 또한 더 빠른 시간 내에 병원체 검출 가능성을 타진하기 위해 다른 신장 시간 2초를 적용한 전체 소요 시간 12분 17초(Ramping time 포함)에서는 103 copies의 N. ceranae 16S를 제외한 5종 질병(6종의 유전자)만을, 그리고 신장 시간 1초, 전체 소요 시간 11분 37초(Ramping time 포함)에서는 N. ceranae 16S와 M. plutoniuns 16S를 제외한 5종 질병(5종의 유전자)만을 검출할 수 있었다 (Table 6).

Table 5. 
Detection limit of UR multi-PCR and Ct and Tm values
Pathogen P. larvae M. plutonius M. plutonius. (gyrase) A. apis A. flavus N. ceranae N. apis
Detection limit 103 103 103 103 103 103 103
Ct 26 34 35 34 24 30 30
Tm 88.26±0.81 87.31±0.41 80.64±0.36 87.78±1.01 89.06±0.66 81.53±0.76 78.62±0.83

Table 6. 
The minimum running time for UR multi-PCR detection
Total running time
(With ramping time)
P. larvae M. plutonius M. plutonius. (gyrase) A. apis A. flavus N. ceranae N. apis β-actin
12min 57sec (1sec, 1sec, 3sec ) + + + + + + + +
12min 17sec (1sec, 1sec, 2sec ) + + + + + + + +
11min 37sec (1sec, 1sec, 1sec ) + + + + + + + +

꿀벌 성봉을 이용한 초고속 다중 PCR의 유효성 평가

UR multi-PCR의 유효성을 평가하기 위하여, 질병에 걸린 꿀벌 시료로 부터 gDNA를 분리하였으며, 이를 주형으로 감염된 병원체의 검색을 수행하였다. 꿀벌질병시료로 부터 6종 꿀벌 병원체 중 Aspergillus flavusNosema ceranae의 존재를 확인할 수 있었으며, 이는 해당 꿀벌 한 마리로부터 회수한 gDNA 50ng을 사용하여 UR multi-PCR을 진행하였다(Fig. 8).


Fig. 8. 
UR multi-PCR for detecting and from a honeybee sample. UR multi-PCR was performed with 50ng gDNA from an infected honeybee sample as initial templates. The PCR condition was 95°C, 15 sec of pre-denaturation, 95°C, 1 sec of denaturation, 60°C, 1 sec of annealing, 72°C, 3 sec of polymerization in each cycle for 40 cycles. , and β-actin gene were amplified. Panel A is the fluorescent graph of amplification with gDNA of infected honeybee sample. Panel B is the peak graph of Tm value.

UR multi-PCR 결과에서, Aspergillus flavusNosema ceranae 특이 유전자 증폭과 함께 비 특이적인 증폭이 관찰되고 있으나, 각 산물의 융점분석에서 특이 병원체 유전자의 증폭과 비특이적 유전자 증폭을 쉽게 구분할 수 있었다. 측정된 Aspergillus flavusNosema ceranae의 Tm값은 각각 89.21°C, 82.07°C로, 각 병원체의 양성 증폭의 Tm값 범위(89.57±0.36°C과 81.80±0.65°C) 안에 해당함으로 해당 병원체의 증폭임을 판정할 수 있었다(Table 7).

Table 7. 
Ct and Tm value of UR multi-PCR detection with honey sample
Pathogen P. larvae M. plutonius M. plutonius. (gyrase) A. apis A. flavus N. ceranae N. apis β-actin
Ct 28 33 0 28 23 26 26 21
Tm 72.79 0 0 83.50 89.21 82.07 82.43 81.36
Result - - - - + + - +

본 실험에서 확인한 두 가지 질병 이외 나머지 4가지 질병에 대해서 형광 그래프 및 융점 분석을 통한 질병 진단이 가능하였으며, 성봉과 같은 천연 시료 사용에 따른 비 특이적 증폭현상이 관찰되었지만, 모두 전형적 비특이적 증폭에 따른 온도변화, 즉 온도변화의 곡선이 약하게(dF/dT), 다수의 Tm값이 형성되며, 특이 유전자 증폭과는 쉽게 구분될 수 있었다(Fig. 8B).

본 PCR법을 양봉 현장에서 보다 쉽게 사용하기 위하여, 성봉 또는 유충으로부터 보다 간소화된 핵산 추출 방법의 개발이 필요할 것으로 보며, 이런 간편한 핵산 분리법과 본 초고속 PCR법이 연합될 수 있다면, 바로 현장에서 유전자 검사를 빠르게 수행할 수 있을 것이다. 더 나아가 본 연구에서 적용한 DNA기반 병원체뿐만 아니라 꿀벌의 RNA 바이러스에 대하여도 본 연구와 같은 신속한 검출법 개발로 연구가 확장될 것으로 기대하는 바이다.


적 요

꿀벌 6종 주요 감염성 질병을 동시 진단하기 위한 PCR-chip 기반 초고속 다중 PCR 진단법을 개발 하였다. 6종 주요 꿀벌 감염성 병원체들은, 세균성 질병인 미국부저병의 원인균, Paenibacillus larvae와 유럽부저병의 원인균인 Melissococcus plutonius, 또한 진균인 Ascosphaera apis(백묵병), Aspergillus flavus(석고병)와 Nosema apis, Nosema ceranae(노제마병)를 선발하였다. 개발된 PCR-chip 기반 초고속 다중 PCR은, 꿀벌주요 병원체 6종에 대하여 각기 103 분자이상이 존재할 경우 모두 성공적 증폭을 보였으며, 증폭여부의 확인에 걸린 시간(Ct-time)은 6종 중 4종은 9분 내외, 2종은 7분 내외이었으며, 총 40회전의 PCR은 11분 42초, 융점분석 1분 15초로 총 PCR분석에 소요된 시간은 12분 57초(40회전 및 융점분석)이었다. 표준 DNA 기질을 사용한 PCR-chip 기반 초고속 다중 PCR은 100%에 근접한 정확도를 보였으며, 꿀벌 genomic DNA를 사용한 실험에서 false-amplification은 발견되지 아니하였다. PCR-chip 기반 초고속 다중 PCR은 실험실 내 초고속 진단 뿐 아니라 양봉 현장에서도 신속하고 효율적인 병원체 검출법이 될 것으로 기대한다.


Acknowledgments

본 연구는 농림축산식품부의 재원으로 농림수산식품기술기획평가원의 수출전략기술개발사업(115067-02), 첨단생산기술개발사업(115058-02, 115102-03), 농생명산업기술개발사업(312027-03)과 2017학년도 경기대학교 대학원 연구원장학생 장학금 지원에 의하여 수행되었습니다.


인 용 문 헌
1. 강민희, 김일욱, 유미선, 권순환, 윤병수, (2008), 꿀벌(Apis mellifera L.)에서 Israeli Acute Paralysis Virus (IAPV) 진단을 위한 PCR 법의 개발, Journal of Apiculture, 23(1), p29-36.
2. 왕지희, 민상현, 임수진, 윤병수, (2016a), 꿀벌의 석고병, 백묵병 현장 진단을 위한 신속 Ascosphaera apisAspergillus flavus 검출법 개발, Journal of Apiculture, 31(1), p31-39.
3. 왕지희, 이도부, 구수진, 백문철, 민상현, 임수진, 이칠우, 윤병수, (2016b), 다중 PCR 증폭과 특이 DNA-chip을 활용한 꿀벌 주요 11종 병원체의 검출법 개발, Journal of Apiculture, 31(2), p133-146.
4. 유미선, 김을환, 강민희, 한상훈, 권순환, 윤병수, (2007), 국내 양봉장에서 Kashmir Bee Virus (KBV)의 검출과 이의 분자생물학적 고찰, Journal of Apiculture, 22(1), p33-42.
5. 유미선, 김일욱, 강민희, 한상훈, 윤병수, (2008a), Black Queen Cell Virus 진단을 위한 Real-Time PCR 진단법의 개발, Journal of Apiculture, 23(1), p37-42.
6. 유미선, 김일욱, 강민희, 한상훈, 윤병수, (2008b), Kashmir Bee Virus 와 Israel Acute Paralysis Virus 의 동시 진단을 위한 Real-Time PCR 진단법의 개발, Journal of Apiculture, 23(2), p97-102.
7. 유미선, 윤병수, (2009), 2009년 국내 꿀벌 질병의 발생 빈도, Journal of Apiculture, 24(4), p273-278.
8. 유미선, 최용수, 박용하, 윤병수, (2010), Chronic Bee Paralysis Virus 의 진단을 위한 Real-Time PCR 진단법의 개발, Journal of Apiculture, 25(1), p31-37.
9. 이혜민, 하정순, 조용호, 남성희, 윤병수, (2004), 꿀벌 진균성 질병의 신속 확인을 위한 Ascosphera apis, Aspergillus flavus의 PCR 검출법, Journal of Apiculture, 19(2), p139-148.
10. 하정순, 이혜민, 김동수, 임운규, 윤병수, (2005), 유럽부저병(European Foulbrood)의 신속 확인을 위한 Melissococcus Pluton의 PCR Detection Method, Journal of Apiculture, 20(1), p9-18.
11. Frazer, J. L., K. M. Tham, M. Reid, M. van Andel, A. M. McFadden, E. Forsgren, J. L. Pettis, H. Pharo, (2016), First detection of Nosema ceranae in New Zealand honey bees, Journal of Apicultural Research, 54(4), p358-365.
12. Lee, J. S., S. J. Yong, H. Y. Lim, B. S. Yoon, (2015), A Simple and Sensitive Gene-Based Diagnosis of Aspergillus flavus by Loop-Mediated Isothermal Amplification in Honeybee, Journal of Apiculture, 30(1), p53-59.
13. Lee, J. S., G. T. H. Luong, B. S. Yoon, (2016), Development of infield- diagnosis of Aspergillus flavus by Loop-Mediated Isothermal Amplification in Honeybee, Journal of Apiculture, 31(1), p25-30.
14. Lim, H. Y., (2013), Development of Novel Rapid Detection Method for Deformed Wing Virus (DWV) using Ultra-Fast High-Performance PCR (UF-HP PCR), Journal of Apiculture, 28(4), p237-244.
15. Lim, H. Y, and B. S. Yoon, (2013), Rapid and Sensitive detection of Deformed Wing Virus (DWV) in Honeybee using Ultra-rapid Real-time PCR, Journal of Apiculture, 28(2), p121-129.
16. Lim, H. Y., S. J. Yong, J. G. Lee, M. J. Ji, O. M. Lee, B. S. Yoon, (2014), Development of Specific PCR Method for Detection of Nosema apis Based on Nucleotide Sequence, Journal of Apiculture, 29(1), p27-33.
17. Luong, G. T. H., J. S. Lee, S. J. Yong, B. S. Yoon, (2015), Development of Ultra-Rapid Reverse Transcription Real- Time PCR for Detection against Black Queen Cell Virus in Honeybee, Journal of Apiculture, 30(3), p171-179.
18. Roetschi, A., H. Berthoud, R. Kuhn, A. Imdorf, (2008), Infection rate based on quantitative real-time PCR of Melissococcus plutonius, the causal agent of European foulbrood foulbrood, in honeybee colonies before and after apiary sanitation, Apidologie, 39(3), p362-371.
19. Van Nguyen, P., J. N. No, S. H. Han, S. H. Kwon, Y. H. Park, B. S. Yoon, (2010), Development of Sacbrood Virus-specific PCR detection based on stable Capsid Protein Sequence, Journal of Apiculture, 25(2), p115-122.
20. Van Nguyen, P., B. R. Lee, M. S. Yoo, B. S. Yoon, (2012), Development and Clinical Validation of a DNA Gyrase Subunit B Gene Based Loop-Mediated Isothermal Amplification Method for Detection of Melissococcus plutonius, Journal of Apiculture, 27(1), p51-58.
21. Wilkins, S., M. A. Brown, A. G. Cuthbertson, (2007), The incidence of honey bee pests and diseases in England and Wales, Pest management science, 63(11), p1062-1068.
22. Yang, X., D. L. Cox-Foster, (2005), Impact of an ectoparasite on the immunity and pathology of an invertebrate: evidence for host immunosuppression and viral amplification, Proceedings of the National Academy of Sciences of the United States of America, 102(21), p7470-7475.
23. Yoo, M. S., J. N. No, B. R. Lee, Y. H. Park, B. S. Yoon, (2011), Development of Ultra-Rapid Real-Time PCR Method for the Detection of Nosema, Journal of Apiculture, 26(1), p21-27.