The APICULTURAL SOCIETY OF KOREA
1

Journal Archive

Journal of Apiculture - Vol. 37 , No. 1
[Paper List] [Go to Volume List]

[ Original research article ]
Journal of Apiculture - Vol. 37, No. 1, pp. 59-66
Abbreviation: J. Apic.
ISSN: 1225-0252 (Print)
Print publication date 30 Apr 2022
Received 1 Apr 2022 Revised 14 Apr 2022 Accepted 20 Apr 2022
DOI: https://doi.org/10.17519/apiculture.2022.04.37.1.59

수벌번데기 추출물이 U937 세포주에서 TNF-α, IL-1β, IL-6 생성에 미치는 영향
김선미 ; 김세건 ; 김효영 ; 우순옥 ; 최홍민 ; 문효정 ; 한상미*
국립농업과학원 농업생물부

Effect of Drone Pupa on the Secretion of Interleukin-1beta, Tumor Necrosis Factor-alpha, and Interleukin-6 in the Human Monocytic Cell Line U937
Seonmi Kim ; Se-Gun Kim ; Hyo Young Kim ; Soon Ok Woo ; Hong Min Choi ; Hyo-Jung Moon ; Sang Mi Han*
Department of Agricultural Biology, National Institute of Agricultural Science, Rural Development Adminstration, Wanju 55365, Republic of Korea
Correspondence to : * E-mail: sangmih@korea.kr

Funding Information ▼
Abstract

Drone pupa has a high fat content including a variety of unsaturated fatty acids. Unsaturated fatty acids have the effect of preventing diseases by suppressing inflammatory reactions. To determine whether these drone pupa extracts have anti-inflammatory activity, changes in expression of IL-1, IL-6, and TNF-α were investigated with the LPS induced inflammatory model on a phorbol 12-myristate 13-acetate (PMA)-induced macrophage-like U937 cell. IL-1β was detected 83.47 pg/mL during LPS treatment alone, and in cells treated with drone pupa extract, it decreased to 1.74, 38.21 pg/mL depending on the concentration of drone pupa extract. At this time, the IL-1β gene expression level also changed. IL-6 was detected at 221 pg/mL in the LPS alone treatment group, and it was found that the amount decreased to 23.84, 71.37 pg/mL in cells treated with drone pupa together. TNF-α was detected 219.57 pg/mL in cells treated with LPS alone and 223.9 and 189.9 pg/mL in cells treated with drone pupa extract. Also, TNF-α gene expression level changed. Our results show that IL-1β, IL-6, and TNF-α influenced not only the protein level but also the gene expression level in the drone pupa extract. Therefore, it is showed that the drone pupa extract has an anti-inflammatory effect.

Keywords: Pro-inflammatory cytokines, Drone pupa extract, Anti-inflammatory effect
서 론

수벌번데기는 벌목에 속한 꿀벌 종인 Apis mellifera L strain에서 생산한 식용곤충으로 2022년 식품원료로 허가되어 다양한 식품 제형에 적용 가능하게 되었다. 수벌번데기는 51.8%의 조단백, 15.9% 탄수화물과 26.2%의 조지방을 함유하는 것으로 분석되었으며 미량원소 및 비타민 등이 존재하는 우수한 식품원료로 평가되었다. 또한 수벌번데기는 갈색거저리, 흰점박이꽃무지 등과 같은 식용곤충처럼 지방함량이 높으며 다양한 불포화지방산을 함유하는 것으로 알려졌다 (Kim et al., 2018). 불포화지방산은 지방산 사슬 내에 한 개 이상의 이중결합을 갖는 지방산으로 염증반응 억제 및 혈중 콜레스테롤 수치를 낮춰 심혈관계 질환을 예방하는 효과가 보고된 바 있으며 (Pereira et al., 2014), 이 외 지방산의 항균 작용에 대한 연구도 진행되고 있다 (Desbois and Smith, 2010; Parsons et al., 2012; Casillas-Vargas et al., 2021).

염증은 유해한 자극에 대한 생체반응 중 하나로 면역세포, 혈관, 염증 매개체들에 의해 시작된다. 또한 염증은 선천 면역에 의해 매개되는 비특이적 반응으로, 목적은 세포의 손상을 초기 단계에서 억제하고, 상처 부분의 파괴된 조직 및 괴사된 세포를 제거하며, 동시에 조직을 재생하는 과정이다. 염증반응을 일으키는 물질로는 병원체, 손상된 세포, lipopolysaccharide (LPS)나 palmitate 같은 자극 물질, 위험신호 등이 존재하며 이들은 monocyte-macrophage 계통의 세포들을 활성화하여 pro-inflammatory gene 발현을 유도하며 anti-inflammatory gene 발현을 억제하게 한다 (Tsutsumi-Ishii et al., 2003; Pereira et al., 2014; Yamadera et al., 2018; Zhao et al., 2018; Ubanako et al., 2019; Viola et al., 2019; Choi et al., 2021; Park et al., 2021). Macrophage는 거의 대부분 조직에 존재하며 일부 혈액 내에 monocyte 형태로 존재하며 바이러스나 세균에 의한 감염, 암세포 성장을 막아주는 역할과 세포성 및 체액성 면역을 조절하는 면역반응에 중요한 세포로 알려져 있다 (Ubanako et al., 2019). Cytokine은 감염, 면역반응, 염증 등과 같은 반응의 조절자로 분비되는 polypeptide이다 (Wang et al., 1995; Ubanako et al., 2019). 이러한 cytokine들은 여러 질병에 관여되어 있어 치료제 target으로 연구되어 왔으며 최근에는 코비드-19 치료제로서 연구개발이 진행되고 있다 (Bezold et al., 2019; Buckley et al., 2020; Kim et al., 2021a; Olbei et al., 2021).

염증이 일어났을 때, monocyte가 말초 혈액을 통해 염증반응이 일어난 곳으로 이동하여 활성화되면 macrophage가 된다 (Zhao et al., 2018). 이렇게 활성화된 macrophage는 TNF-α, IL-6 같은 pro-inflammatoy cytokine을 생산하게 된다.

이에 우리는 사람 유래 monocytic cell line인 U937에 phorbol 12-myristate 13-acetate (PMA)를 처리하여 macrophage-like cell로 활성화하였다. 이 활성화된 세포에 염증반응을 유도하기 위하여 그람 음성균의 내독소인 LPS를 처리하여 인위적 염증반응을 유도하였다. 이 때 수벌번데기 추출물이 급성 염증반응에 관여하는 cytokine인 IL-1β, IL-6, TNF-α에 대한 억제 효과를 알아보고자 하였다.

재료 및 방법
1. 수벌번데기

수벌번데기는 2019년 양봉농가에서 구입하여 사용하였다. 이는 채취 후 즉시 -20℃ 냉동 보관한 것으로 동결건조하여 분말로 제조하였다 (Kim et al., 2019).

1) 수벌번데기 추출물

수벌번데기 분획추출물은 먼저 수벌번데기 동결건조 분말 시료에 70% 에탄올을 넣고 3시간 동안 Sonicator를 이용해 분말 시료를 녹인 후 rotary vacuum evaporator를 사용하여 40℃에서 감압농축하여 에탄올 추출물을 얻었다. 헥산, 에틸아세테이트, 부탄올 순서로 분획추출물과 물층을 상기와 동일한 방법으로 감압 농축하였다. 이들 중 물층을 PBS (Phosphate Buffered Saline)에 녹여 사용하였다 (Kim et al., 2021b).

2. Cell viability assay

U937 cell은 사람유래 monocytic cell line으로 10% fetal bovine serum (GIBCO)과 1× penicillin-streptomycin (GIBCO)을 첨가한 RPMI1640 (GIBCO)을 사용하여 37℃, 5% CO2의 조건에서 배양하였다. U937 세포에 대한 수벌번데기 분획물의 세포독성을 확인하기 위하여 1×104 cells/well로 96 well plate에 분주하여 18시간 동안 세포를 배양시킨 후 수벌번데기 분획추출물 10, 5, 1, 0.5, 0.1, 0.05 mg/mL 농도로 처리하여 24, 48, 72, 96시간 동안 배양하였다. 각 well 당 U937 세포배양액 100 μL에 10%가 되도록 Ez-Cyto solution을 10 μL씩 첨가하고 3시간 동안 37℃, 5% CO2 조건에서 반응시킨 후 microplate reader를 이용하여 490 nm에서 흡광도를 측정하였다.

3. Enzyme-linked immunesorbent assay (IL-1β, IL-6, TNF-α)

1×106 cells/mL의 U937 세포에 PMA를 최종 농도100 nM로 처리하여 24시간 동안 37℃, 5% CO2 조건에서 배양시켰다. PMA를 처리한 U937 세포를 1×105/mL로 6 well plate에 분주한 후 1.25 μg/mL 농도의 lipopolysaccharide (LPS)와 수벌번데기 분획추출물 각각의 단독 처리군, lipopolysaccharide (LPS)와 수벌번데기 분획추출물 동시 처리군, 수벌번데기 분획추출물 24시간 처리 후 LPS 처리 군으로 나누어 24시간 동안 37℃, 5% CO2 조건에서 반응 시켰다. 이후 세포배양액을 모아 enzyme-linked immunosorbent assay (ELSIA) kit (R&D systems)를 사용하여 각 처리군의 cytokine의 변화를 측정하였다.

4. Real time-reverse transcriptase-PCR

U937 세포는 ELISA assay와 동일한 반응 조건으로 1×106 cells/mL에 100 nM로 PMA를 24시간 동안 처리하고 1.25 μg/mL 농도의 LPS와 수벌번데기 분획추출물의 단독 처리군, LPS와 수벌번데기 분획추출물 동시 처리군, 수벌번데기 분획추출물 처리 후 LPS 처리군으로 나누어 2, 4, 8, 16시간 동안 37℃, 5% CO2 조건에서 반응시켰다. 이후 세포를 모아 RNA purification kit (QIAGEN)를 사용하여 RNA를 분리하였다. 분리한 RNA는 2× Rapi-detect mix를 사용하여 Bio-Rad 사의 CFX96TM Real-time system 기기를 사용하여 60℃에서 5분 동안 cDNA를 합성한 후 95℃ 10초, 60℃ 20초, 72℃ 20초 반응 조건으로 40 cycle 동안 PCR을 수행하였다. 목적 유전자 IL-1β, IL-6, TNF-α 발현의 변화를 각 목적유전자 Ct 값과 대조군으로 β-actin 유전자의 Ct 값의 상대적 비율로 분석하였다. Real-time reverse transcriptase-PCR에 사용한 프라이머 염기서열은 Table 1에 나타내었다.

Table 1. 
Sequence of primers used for real-time reverse transcriptase PCR
Name Sequence Reference
IL-1B_F CCACAGACCTTCCAGGAGAATG Erndt-MarinoandHahn, 2016
IL-1B_R GTGCAGTTCAGTGATCGTACAGG
IL-6_F AGACAGCCACTCACCTCTTCAG
IL-6_R TTCTGCCAGTGCCTCTTGCTG
TNFa_F CTCTTCTGCCTGCTGCACTTTG
TNFa_R ATGGGCTACAGGCTTGTCACTC
bActin_F CACCATTGGCAATGAGCGGTTC
bActin_R AGGTCTTTGCGGATGTCCACGT

5. 통계처리

모든 실험의 결과는 3반복하여 평균 및 표준편차로 표기하였고 통계분석은 각 시료 간의 유의적 변화를 t-test로 분석, 판정하였다 (*P<0.05, **P<0.01, ***P<0.001).

결 과
1. U937 세포에서 수벌번데기 분획추출물의 cell viability

수벌번데기 추출물을 U937 세포주에 처리하였을 때 세포독성을 알아보기 위하여 10, 5, 1, 0.5, 0.1, 0.05 mg/mL의 농도를 1×104 cell/well에 처리하여 96시간까지 반응시킨 결과 수벌번데기 추출물을 처리하지 않은 실험군과 비교하였을 때 10 mg/mL 농도로 수벌번데기 추출물을 처리하였을 시 수벌번데기 추출물 처리 시간에 의존적으로 생존력이 증가하는 것으로 나타났다. 5 mg/mL 농도로 처리한 실험군에서는 10 mg/mL 처리군보다 생존력은 떨어지게 나타났다. 그 외 1, 0.5, 0.01, 0.05 mg/mL 농도의 수벌번데기 추출물 처리군은 수벌번데기 추출물을 처리하지 않은 대조군과 비슷한 수준으로 나타났다 (Fig. 1). 수벌번데기 추출물은 농도와 시간에 의존적으로 U937 세포 생존력에 영향을 주는 결과를 얻었으며 처리한 농도에서 세포독성은 나타나지 않았다. 이에 따라 U937 세포에서 세포독성 없이 항염증 효과를 알아볼 수 있는 수벌번데기 추출물의 농도는 5 mg/mL 이상, 10 mg/mL의 수준으로 72시간까지 처리 가능한 것으로 판단하였다.


Fig. 1. 
Viability of U937 cells in water fraction of drone pupa extract. U937 cells were seeded on 96 well plates at a density of 1×104/well. After sixteen hours, the water fraction of drone pupa extract was treated for 24, 48, 72, 96 hrs. And then the Ez-cyto reagent was added, incubated for 3 hrs, and the OD value was measured at 450 nm. The values are expressed as the mean±STD (n=3). t-test was used to calculated statistical significance. *P≤0.05; **P≤0.01; ***P≤0.0001

2. 수벌번데기 분획추출물이 U937 세포에서 LPS로 유도된 염증성 cytokine 생성에 미치는 영향

급성 염증반응에 관여하는 cytokine의 단백질 발현 수준에서 수벌번데기 추출물의 영향을 알아보기 위하여 phorbol 12-myristate 13-acetate (PMA)를 처리하여 U937 세포를 macrophage로 활성화 시킨 후 LPS를 처리하여 급성염증반응을 인위적으로 유도한 후 IL-1β, IL-6, TNF-α의 분비량의 변화를 알아보았다. 그 결과 IL-1β는 LPS 단독처리 시 83.47±0.03 pg/mL이 검출되었고 수벌번데기 추출물 단독처리군에서는 IL-1β가 검출되지 않았다. 반면 LPS와 수벌번데기 추출물을 함께 처리한 세포에서는 수벌번데기 추출물의 농도에 따라 1.74±0.01, 38.21±0.01 pg/mL로 감소하였다. 또한 수벌번데기 추출물을 세포에 먼저 24시간 동안 처리한 후 LPS로 염증반응을 유도하였을 때도 40.77±0.01, 37.65±0.04 pg/mL로 감소함을 확인하였다 (Fig. 2).


Fig. 2. 
Effects of DP treatment on lipopolysaccharide (LPS)-induced IL-1β production. Human U937 monocytes at densities of 1×105 cell/mL were treated with 1.25 μg/mL LPS that pretreated with DP extract or combination with DP extract. IL-1β levels in the supernatants were determined via enzyme-linked immunosorbent assay (ELISA) after 24 h of treatment. The values are expressed as the mean±STD (n=3). t-test was used to calculated statistical significance. *P≤0.05; **P≤0.01; ***P≤0.0001

IL-6는 LPS 단독 처리하였을 때 221.34±0.05 pg/mL로 검출되었다. 수벌번데기 추출물을 단독으로 세포에 처리하였을 때는 1.09, 0.73 pg/mL로 적은 양이 검출되었고 LPS와 수벌번데기 추출물을 동시에 처리한 세포에서는 처리한 추출물의 농도에 따라 23.84±0.001, 71.37±0.001 pg/mL로 LPS 단독 처리했을 때보다 그 양이 감소하는 것을 볼 수 있었다. IL-6는 수벌번데기 추출물을 먼저 처리한 후 염증반응을 유도하였을 때 10.73±0.002, 37.28±0.003 pg/mL로 동시 처리하였을 때보다 더 감소되었음을 확인할 수 있었다 (Fig. 3).


Fig. 3. 
Effects of DP treatment on lipopolysaccharide (LPS)-induced IL-6 production. Human U937 monocytes at densities of 1×105 cell/mL were treated with 1.25 μg/mL LPS that pretreated with DP extract or combination with DP extract. IL-6 levels in the supernatants were determined via enzyme-linked immunosorbent assay (ELISA) after 24 h of treatment. The values are expressed as the mean±STD (n=3). t-test was used to calculated statistical significance. *P≤0.05; **P≤0.01; ***P≤0.0001

TNF-α는 LPS를 단독으로 처리한 세포에서 219.57±0.02 pg/mL이 검출되었으며 수벌번데기 추출물을 단독 처리한 세포에서는 처리한 농도에 따라 24.84±0.004, 0.68±0.001 pg/mL 검출되었고 수벌번데기 추출물과 동시에 처리된 세포에서는 223.92±0.01, 189.94±0.01 pg/mL 검출되었다. 또한 수벌번데기 추출물을 24시간 먼저 처리한 후 LPS을 처리하였을 때 320.93±0.11, 501.71±0.01 pg/mL 검출되는 것을 알 수 있었다 (Fig. 4).


Fig. 4. 
Effects of DP treatment on lipopolysaccharide (LPS)-induced TNF-α production. Human U937 monocytes at densities of 1×105 cell/mL were treated with 1.25 μg/mL LPS that pretreated with DP extract or combination with DP extract. TNF-α levels in the supernatants were determined via enzyme-linked immunosorbent assay (ELISA) after 24 h of treatment. The values are expressed as the mean±STD (n=3). t-test was used to calculated statistical significance. *P≤0.05; **P≤0.01; ***P≤0.0001

세 가지 cytokine에 대한 ELISA를 이용한 양적 분석은 각 표준물질을 이용하여 회귀식을 구하였으며 사용한 제품의 방법에 따라 4-paralogistic curve를 작성하여 얻은 회귀식 y={A-D/1+ (x/C)B}+D을 통해 계산하였으며 이때 R 값은 1이었다.

3. 수벌번데기 분획추출물이 U937 세포에서 LPS로 유도된 염증성 cytokine 유전자 발현의 영향

수벌번데기 추출물을 U937 세포에 처리하였을 때 인위적 염증반응 유도 시 관여하는 cytokine 유전자 발현에 미치는 영향을 알아보기 위해 U937 세포의 RNA를 주형으로 PCR를 수행하였다. U937 세포에서 IL-1β, IL-6, TNF-α 유전자의 발현은 β-actin의 발현량과 비교한 비율로 정량화하였다. 그 결과 IL-1β 유전자는 수벌번데기 추출물과 LPS를 동시에 2시간 동안 처리한 세포와 LPS 단독 처리한 세포와 비교하였을 때 IL-1β 유전자 발현 감소를 볼 수 있었으며 24시간 동안 수벌번데기 추출물 처리 후 LPS를 처리한 세포에서는 4시간 반응시간 후 IL-1β 유전자가 감소함을 알 수 있었다. 또한 IL-6의 경우 IL-1β 유전자와 비슷한 양상을 보였으며 TNF-α 유전자는 4시간 반응까지 수벌번데기 단독 처리한 세포와 LPS를 함께 처리한 세포에서의 유전자 발현이 LPS 단독 처리한 세포에서 보다 감소하였다.


Fig. 5. 
Effects of DP treatment on lipopolysaccharide (LPS)-induced IL-1β, IL-6, and TNF-α mRNA expression after 2, 4, 8, and 16 h. Human U937 cells at densities of 1×105 cell/mL were treated with 1.25 μg/mL LPS that pretreated with DP extract or combination with DP extract. IL-1β, IL-6, TNF-α gene expression levels were determined via real-time reverse transcriptase PCR after 2, 4, 8, 16 h of treatment. Each cytokine gene mRNA expression level (A) at 12.5 mg/mL, (B) 6.25 mg/mL DP extract. 1, Control; 2, LPS1.25_2; 3, LPS1.25_4; 4, LPS1.25_8; 5, LPS1.25_16; 6, DP_2; 7, DP_4; 8, DP_8; 9, DP_16; 10, DP+LPS1.25_2; 11, DP+LPS1.25_4; 12, DP5+LPS1.25_8; 13, DP+LPS1.25_16; 14, 24_DP_2; 15, 24_DP_4; 16, 24_DP_8. The values are expressed as the mean±STD (n=3).

고 찰

수벌번데기는 우수한 영양성분을 갖는 미래 식량의 대체인 식용 곤충의 하나로 우리나라에서는 2022년 식품원료로 허가되어 다양한 식품에 응용될 수 있는 길이 열렸다. 식품원료로서 뿐 아니라 수벌번데기 추출물에서 항당뇨, 항산화 효과 및 ADH 활성에 대한 연구와 지속적으로 수벌번데기의 약리 작용에 대한 과학적 근거를 마련하고자 노력하고 있다 (Kim et al., 2020; Kim et al., 2021b). 최근 식품원료로 허가되어 있는 식용 곤충들에 대한 다양한 약리적 효능에 대한 연구가 꾸준히 진행되고 있으며 이들 중 항염증 효과를 갖는 펩타이드를 스크린하고 그 효능에 대한 보고가 있었다 (Tsutsumi-Ishii et al., 2003; Stull et al., 2018; Yamadera et al., 2018; Choi et al., 2021; Park et al., 2021).

근래 현대인에게 가장 위협이 되는 질벙으로 많이 알려진 암, 당뇨, 동맥경화, 고혈압, 뇌졸증과 크론병, 아토피성 피부염 등과 같은 만성 질환과 치매와 같은 퇴행성 질환에서의 antigen-presenting cell (APC)로 알려져 있는 macrophage의 과도한 활성화는 염증 매개 물질들을 다량 분비하게 유도함으로써 임상적 증상의 영향을 주게 된다고 보고된 바 있다 (Bennett et al., 2018; Lee et al., 2020). 이러한 염증 매개 물질로서 IL-1β, IL-6, TNF-α IL-4, IL-8, IL-10, IL-21 등과 같은 cytokine이 있으며 급성 염증반응 관련 cytokine은 TNF-α, IL-1β, IL-6가 있다. TNF-α는 그람 음성 세균을 포함한 병원체에 의한 급성 염증반응의 매개자이며 나아가 중증 감염의 전신적 합병증의 원인이 되며 이외에도 항종양 활성, 분화, 증식을 조절하는 기능도 있다. IL-1β는 감염이나 자극에 대한 염증반응 매개자로서 monocyte, macrophage, 비만세포, 백혈구, 신경세포 등 다양한 세포에서 분비되는 것으로 알려져 있고 그 역할도 다양하여 T, B, NK 세포 등과 염증반응을 통한 면역 반응과 관련성을 보고하고 있다. IL-6는 선천 면역 및 후천 면역 모두에 기능을 하는 cytokine으로 T cell, B cell, monocyte가 분비하는 것으로 보고된 바 있으며 급성기 염증반응에 관여한다고 알려져 있다 (Chung et al., 2010). 사람 monocytic cell인 U937 세포는 RAW264.7과 함께 많은 염증반응 및 면역반응 관찰에 사용되고 있으며 PMA라는 약제로 macrophage-like cell로 활성화하여 연구하였다 (Haidet et al., 2012; Yamadera et al., 2018; Prasad et al., 2020). 이처럼 LPS로 인위적 염증반응을 유도하였을 때 수벌번데기 추출물은 염증 매개 cytokine의 분비를 억제하는 효과를 보였다. IL-1β, IL-6, TNF-α 각각은 LPS 단독 처리 시 양적 차이를 나타내며 모두 분비었고 LPS와 수벌번데기 추출물을 동시에 처리하였을 때, 수벌번데기 추출물을 먼저 처리한 후 염증반응을 유도하였을 때 모두 IL-1β와 IL-6는 단백질 발현 수준에서 감소함을 알 수 있었다. 또한 유전자 발현은 β-actin 유전자를 대조군으로 하여 상대적 분석을 하였을 때 유전자 수준에서 감소하는 경향을 보였다. 그러나 TNF-α는 수벌번데기 추출물을 처리하였을 시 분비량이 억제되는 양상을 보이지 않았고 또한 수벌번데기 추출물을 단독 처리하였을 때도 일정 수준 TNF-α의 분비가 유도되는 것으로 나타났다. 이것으로 보아 수벌번데기 추출물은 IL-1β와 IL-6를 줄이는 효과가 보였으나 TNF-α를 줄이는 효과는 볼 수 없었다. 그러나 TNF-α는 pro-inflammatory 역할 뿐 아니라 항종양활성을 갖고 있다 (Webster and Vucic, 2020). 다양한 암세포에서 apoptosis를 유도하는 역할이 다수 보고된 바 있어 추후 수벌번데기 추출물이 암세포에 apoptosis를 유도하는 기전에 대한 연구에서 TNF-α의 관여 여부를 확인해야 할 것으로 판단된다. 이처럼 수벌번데기 추출물 처리는 세포에서 급성 염증반응에 관여하는 cytokine을 단백질 수준과 유전자 수준에서 모두 영향을 줄 수 있다는 결과를 얻었다. 이는 수벌번데기 추출물이 염증 치료 및 예방에 대한 활성이 있음을 추정하게 하였다. 그러나 앞으로 좀 더 다양한 조건에서 수벌번데기 추출물의 항염증 활성에 대한 연구가 수반되어야 할 것이며 또한 항염증 활성을 갖는 물질을 찾는 연구를 통해 식품 원료로서 뿐 아니라 의약소재로서 활용할 수 있기를 기대해 본다.

Acknowledgments

본 연구는 국립농업과학원 농업과학기반기술연구사업 (과제번호: PJ01512902)에 의하여 수행되었습니다.

References
1. Bennett, J. M., G. Reeves, G. E. Billman and J. P. Sturmberg. 2018. Inflammation-Nature’s way to efficiently respond to all types of challenges: Implications for understanding and managing “the epidemic” of chronic diseases. Front. Med. 5: 316.
2. Bezold, V., P. Rosenstock, J. Scheffler, H. Geyer, R. Horstkorte and K. Bork. 2019. Glycation of macrophages induces expression of pro-inflammatory cytokines and reduces phagocytic efficiency. Aging 11(14): 5258-5275.
3. Buckley, L. F., G. F. Wohlford, C. Ting, A. Alahmed, B. W. Tassell, A. Abbate, J. W. Devlin and P. Libby. 2020. Role for anti-cytokine therapies in severe coronavirus disease 2019. Crit. Care. Expl. 2: e0178.
4. Casillas-Vargas, G., C. Ocasio-Malavé, S. Medina, C. Morales-Guzmán, R. García Del Valle and N. M. Carballeira. 2021. Antibacterial fatty acids: an update of possible mechanisms of action and implications in the development of the next-generation of antibacterial agents. Prog. Lipid Res. 82: 101093.
5. Chanput, W., J. J. Mes and H. J. Wichers. 2014. THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 23: 37-45.
6. Choi, R. Y., M. Seo, J. H. Lee, I.W. Kim, M. A. Kim and J. S. Hwang. 2021. Inhibitory effect of protaetiamycine 9 derived from Protaetia brevitarsis seulensis larvae on LPS-mediated inflammation in RAW264.7 cells. J. Life Sci. 31(11): 987-994.
7. Chung, Y. S., M. Choi, I. Park, K.Y., Park and K. H. Kim. 2010. Effects of chitosan on the production of TNF-α, IL-1β, IL-6 in mice. Cancer Prev. Res. 15: 204-210.
8. Desbois, A. P. and V. J. Smith. 2010. Antibacterial free fatty acids: activities, mechanisms of action and biotechnological potential. Appl. Microbiol. Biotechnol. 85: 1629-1642.
9. Erndt-Marino, J. D. and M. S. Hahn. 2016. Probing the response of human osteoblasts following exposure to sympathetic neuron-like PC-12 cells in a 3D coculture model. J. Biomed. Mater. Res. Part A 105A: 984-990.
10. Haidet, J., V. Cifarelli, M. Trucco and P. Luppi. 2012. C-peptide reduces pro-inflammatory cytokine secretion in LPS-stimulated U937 monocytes in condition of hyperglycemia. Inflamm. Res. 61: 27-35.
11. Kim, H. Y., S. O. Woo, S. G. Kim, K. W. Bang and H. M. Choi. 2019. Anti-inflammatory activities of drone pupae (Apis mellifera L.). J. Apic. 34(3): 255-259.
12. Kim, H. Y., S. O. Woo, S. G. Kim, H. M. Choi, H. Y. Moon and S. M. Han. 2020. Antioxidant and antihyperglycemic effects of honeybee drone pupae (Apis mellifera L.) extracts. J. Apic. 35(1): 33-39.
13. Kim, J. S., J. Y. Lee, J. W. Yang, K. H. Lee, M. Effenberger, W. Szpirt, A. Kronbichler and J. I. Shin. 2021a. Immunopathogenesis and treatment of cytokine storm in COVID-19. Theranostics 11(1): 316-329.
14. Kim, S. G., S. O. Woo, K. W. Bang, H. R. Jang and S. M. Han. 2018. Chemical composition of drone pupa of Apis mellifera and its nutritional evaluation. J. Apic. 33(1): 17-23.
15. Kim, S., S. G. Kim, H. Y. Kim, S. O. Woo, H. M. Choi, H. J. Moon and S. M. Han. 2021b. Detection of alcohol dehydrogenase activity in extract of drone pupa. J. Apic. 36(3): 189-194.
16. Lee, H. J., M. Seo, M. Baek, Y. P. Shin, J. J. Lee, I. W. Kim, J. S. Hwang and M. A. Kim. 2020. Inhibitory effect of protaetiamycine 6 on neuroinflammation in LPS-stimulatede BV-2 microglia. J. Life Sci. 30(12): 1078-1084.
17. Olbei, M., I. Hautefort, D. Modos, A. Treveil, M. Poletti, L. Gul, C. D. Shannon-Lowe and T. Korcsmaros. 2021. SARS-CoV-2 causes a different cytokine response compared to other cytokine storm-causing respiratory viruses in severely III patients. Front. Immunol. 12: 629193.
18. Park, W. J. and J. S. Han. 2021. Gryllus bimaculatus extract protects against lipopolysaccharide and palmitate-induced production of proinflammatory cytokines and inflammasome formation. Mol. Med. Rep. 23: 206.
19. Parsons, J. B., J. Yao, M. W. Frank, P. Jackson and C. O. Rock. 2012. Membrane disruption by antimicrobial fatty acids releases low-molecular-weight proteins from Staphylococcus aureus. J. Bacteriol. 194(19): 5294-5304.
20. Prasad, A., M. Sedlářová, A. Balukova, A. Ovsii, M. Rác, M. Křupka, S. Kasai and P. Pospíšil. 2020. Reactive oxygen species imaging in U937 cells. Front. in Physiol. 11: 552569.
21. Pereira, D. M., G. Correia-da-Silva, P. Valentão, N. Teixeira and P. B. Andrade. 2014. Anti-inflammatory effect of unsaturated fatty acids and ergosta-7, 22-dien-3-ol from Marthasterias glacialis: prevention of CHOP-mediated ER-stress and NK-kB activation. PLoS ONE 9(2): e88341.
22. Stull, V. J., E. Finer, R. S. Bergmans, H. P. Febvre, C. Longhurst, D. K. Manter, J. A. Patz and T. L. Weir. 2018 Impact of edible cricket consumption on gut microbiota in healthy adults, a double-blind, randomized crossover trial. Sci. Rep. 8: 10762.
23. Tsutsumi-Ishii, Y. and I. Nagaoka 2003. Modulation of human β-Defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated mononuclear phagocytes via proinflammatory cytokine production. J. Immunol. 170: 4226-4236.
24. Ubanako, P., N. Xelwa and M. Ntwasa. 2019. LPS induces inflammatory chemokines via TLR-4 signalling and enhances the Warburg Effect in THP-1 cells. PLoS ONE 14(9): e0222614.
25. Yamadera, S., Y. Nakamura, M. Inagaki, S. Kenmotsu, T. Nohara, N. Sato, T. Oguchi, M. Tsuji, I. Ohsawa, H. Gotoh, Y. Goto, A. Yura, Y. Kiuchi and S. Iwai 2018. Linagliptin inhibits lipopolysaccharide-induced inflammation in human U937 monocytes. Inflamm. Regen. 38: 13.
26. Viola, A., F. Munari, R. Sánchez-Rodríguez, T. Scolaro and A. Castegna. 2019. The metabolic signature of macrophage responses. Front. Immunol. 10: 1462.
27. Wang, W. and E. Alpert. 1995. Downregulation of phorbol 12-myristate 13-acetate-induced tumor necrosis factor-alpha and interleukin-1β production and gene expression in human monocytic cells by human alpha-fetoprotein. Hepatology 22: 921-928.
28. Webster, J. D. and D. Vucic. 2020. The balance of TNF mediated pathways regulates inflammatory cell death signaling in healthy and diseased tissues. Front. Cell Dev. Biol.
29. Zhao, Y. L., W. W. Liu, W. Liu, Z. Y. Lu, D. H. Xuan, X. Zhang, X. L. Liu, T. Hayashi, M. Yamato, T. Ogura, H. Fujisaki, S. Hattori, S. I. Tashiro, S. Onodera and T. Ikejima. 2018. Phorbol ester (PMA)-treated U937 cells cultured on type I collagen-coated dish express a lower production of pro-inflammatory cytokines through lowered ROS levels in parallel with cell aggregate formation. Int. Immunopharmacol. 55: 158-164.
 
Copyright statement. The Apicultural Society of Korea
In Department of Agricultural Biology, National Institute of Agricultural Sciences, RDA, Wanju 55365, Republic of Korea
Contact: Prof. Hye Kyung Kim(Tel. +82-63-238-9316, E-mail. hyegyeong@korea.kr)
Printed by Junghaengsa, Inc.
(Tel. +82-2-2232-3281, Fax. +82-2-2232-5874, E-mail. jhpub3213@naver.com)