The APICULTURAL SOCIETY OF KOREA
[ Original research article ]
Journal of Apiculture - Vol. 41, No. 1, pp.13-21
ISSN: 1225-0252 (Print)
Print publication date 30 Apr 2026
Received 12 Feb 2026 Revised 10 Mar 2026 Accepted 12 Mar 2026
DOI: https://doi.org/10.17519/apiculture.2026.04.41.1.13

벌꿀 섭취가 초파리(Drosophila melanogaster)의 에탄올 내성과 면역 및 항산화 관련 유전자 발현에 미치는 영향

차주헌1 ; 김영호1, 2, *
1경북대학교 질병매개곤충학과
2경북대학교 생태과학과
Effects of Honey Feeding on Ethanol Tolerance and Immune- and Antioxidant-related Gene Expression in Drosophila melanogaster
JooHeon Cha1 ; Young Ho Kim1, 2, *
1Department of Vector Entomology, Kyungpook National University, Sangju 37224, Republic of Korea
2Department of Ecological Science, Kyungpook National University, Sangju 37224, Republic of Korea

Correspondence to: *E-mail: yhkim05@knu.ac.kr

Abstract

Honey is a representative apicultural product known for its antioxidant, detoxifying, and immunomodulatory properties. However, the molecular mechanisms underlying the effects of honey feeding on chemical stress tolerance in insects have not been fully elucidated. This study investigated the effects of honey feeding on ethanol-induced chemical stress tolerance and related gene expression in Drosophila melanogaster. Adult female flies were reared throughout their lifespan on an artificial diet supplemented with honey and subsequently exposed to various concentrations of ethanol vapor to compare time-dependent survival rates. In addition, expression levels of genes associated with alcohol metabolism(Adh, Aldh), antioxidant responses (SOD1, SOD2, CAT, Trxr1, GstD2, GstD5), and antimicrobial peptides (DptA, DptB, AttC, Mtk) were analyzed by quantitative real-time PCR(qRT-PCR) in surviving flies following ethanol exposure. Honey-fed flies exhibited overall higher ethanol tolerance compared with the control group, particularly showing significantly improved survival during the early phase of exposure under moderate to high ethanol concentrations. Gene expression analysis revealed that alcohol metabolism-related genes were not upregulated in the honey-fed group. In contrast, antimicrobial peptide genes were significantly upregulated prior to ethanol exposure. Antioxidant-related genes showed a marked increase at later time points in the control group, whereas honey-fed flies maintained relatively lower and more stable expression levels. These findings suggest that honey feeding enhances chemical stress tolerance not through increased activation of alcohol-metabolizing enzymes, but rather through pre-activation of immune responses and mitigation of oxidative stress. This study provides molecular evidence supporting the functional physiological effects of honey in insects.

Keywords:

Honey, Drosophila melanogaster, Ethanol tolerance, Antimicrobial peptides, Antioxidant genes

서 론

벌꿀은 꿀벌(Apis mellifera)이 꽃꿀을 채집하여 효소적 변환과 수분 증발 과정을 거쳐 생성하는 천연 양봉 산물로, 주성분인 포도당과 과당 외에도 다양한 유기산, 미네랄, 비타민, 아미노산 및 폴리페놀 화합물을 함유하고 있다 (Ball, 2007). 이러한 복합적인 성분 조성으로 인해 벌꿀은 항산화, 항균, 해독 및 면역 조절 기능을 지닌 기능성 식품으로 널리 인식되어 왔다(Santos-Buelga and González-Paramás, 2025). 기존 연구에서는 벌꿀이 포유류에서 알코올 섭취로 유발되는 산화적 스트레스를 완화하고 간 기능을 보호할 수 있음이 보고된 바 있으며, 이는 벌꿀에 함유된 폴리페놀과 유기산 성분이 활성산소종(reactive oxygen species, ROS)을 직접 제거하거나 산화- 환원 항상성 조절에 기여하기 때문으로 해석되고 있다(Zakhari, 2006; Santos-Buelga and González-Paramás, 2025). 이러한 생리적 효과가 곤충에서도 유사하게 나타나는지, 특히 화학적 스트레스 조건에서 어떠한 분자적 반응을 유도하는지에 대해서는 체계적인 연구가 부족한 상황이다.

초파리(Drosophila melanogaster)는 짧은 생활사와 잘 규명된 유전체, 그리고 다양한 분자생물학적 분석 도구를 갖춘 대표적인 모델 곤충으로 생리·면역·스트레스 반응 연구에 널리 활용되고 있는데(Roberts, 2006; Jennings, 2011), 이는 벌꿀의 생리학적 효과와 관련된 기작 연구에 초파리 모델의 높은 활용 가치를 지지한다. 특히 초파리는 자연 환경에서 부패한 과일을 주요 서식지로 이용하며, 이 과정에서 에탄올, 초산 및 방향족 알코올과 같은 발효 유래 화학물질에 지속적으로 노출된다(Stotzky et al., 1976; Chandler et al., 2012). 이러한 생태적 특성으로 인해 초파리는 에탄올을 포함한 화학적 스트레스에 대한 내성을 진화적으로 발달시켜 온 것으로 알려져 있다. 선행 연구에 따르면, 에탄올 노출은 초파리에서 알코올 대사 관련 유전자뿐 아니라 항산화 및 선천면역 반응을 유도하며, 특히 항균펩타이드(antimicrobial peptides, AMPs)의 발현이 병원체 방어 기능을 넘어 화학적 스트레스 조건에서도 생존에 기여할 수 있음이 보고되었다(Lemaitre and Hoffmann, 2007; Kim et al., 2018; Seong et al., 2020). 실제로 IMD 신호전달 경로를 통해 조절되는 항균펩타이드의 발현을 억제할 경우 에탄올 스트레스 하에서 생존율이 유의적으로 감소하는 현상이 관찰되었다(Kim et al., 2022).

벌꿀의 항산화, 항균, 해독 및 면역 조절 기능(Santos-Buelga and González-Paramás, 2025)과 알코올 섭취로 유발되는 산화적 스트레스 완화 효과(Zakhari, 2006; Santos-Buelga and González-Paramás, 2025), 그리고 초파리가 알코올을 비롯한 다양한 화학적 스트레스에 대해 높은 내성을 보인다는 선행 연구 결과를 종합해 볼 때(Lemaitre and Hoffmann, 2007; Kim et al., 2018; Seong et al., 2020), 초파리 모델을 활용한 연구적 접근은 벌꿀 섭취가 알코올 유도 화학적 스트레스 내성에 관여하는 생리학적 기작을 규명하는 데 유용한 연구 틀을 제공할 수 있을 것으로 판단된다. 이에 본 연구에서는 벌꿀을 첨가한 사료를 섭취한 초파리를 대상으로 에탄올 증기 노출 실험을 수행하여 생존율 변화를 통해 화학적 스트레스 내성을 평가하고, 나아가 알코올 대사 관련 유전자(Alcohol dehydrogenase; Adh, Aldehyde dehydrogenase; Aldh), 항산화 관련 유전자(Superoxide dismutase1, 2; SOD1, 2, Catalase; CAT, Thioredoxin reductase1; Trxr1, Glutathione transferase D2, 5; GST D2, 5) 및 항균펩타이드 유전자(Diptericin A; DptA, Diptericin B; DptB, Attacin-C; AttC, Metchnikowin; Mtk)의 발현 양상을 분석함으로써 벌꿀 섭취가 초파리의 화학적 스트레스 적응에 미치는 분자적 기작을 규명하고자 한다.


재료 및 방법

1. 실험 초파리 및 사육 조건

본 연구에 사용된 초파리(D. melanogaster)는 25±2℃, 광주기 16 : 8 h (명: 암), 상대습도 45~55% 조건에서 표준 사육 배지(Kim et al., 2014; Kim et al., 2018)를 유지하였다. 실험에 사용된 개체는 성충 암컷으로, 우화 후 3~5일령 개체를 대상으로 하였다. 우화 직후 개체는 동일한 사료 조건에서 48시간 동안 유지한 후, 새 사료가 담긴 바이알로 옮겨 추가로 48시간 사육함으로써 실험 개체의 연령을 균일화하였다.

2. 벌꿀 처리 사료 조제

대조군은 표준 사육 배지를 사용하였고, 배지에는 8.8 g의 설탕이 포함되어 있다(Zwaan et al., 1991; Dalton et al., 2011). 벌꿀 처리군은 표준 사육 배지에 벌꿀(야생화꿀, 한국양봉농협, 한국) 11.3 g을 첨가하여 조제하였다. 설탕과 벌꿀은 열량을 계산한 후 동일한 열량의 당분이 공급되도록 각각의 배지에 첨가하였다. 표준 사육 배지에서 유지되던 초파리 성충이 우화한 후 암·수 초파리를 표준 사육 배지(대조군) 또는 벌꿀 포함 배지에서 교미하도록 하여 산란을 유도하였고, 부화한 모든 초파리는 전 생애 동안 해당 처리 배지만을 섭취하도록 하였으며, 배지는 동일한 주기로 교체하여 영양 조건의 차이를 최소화하였다.

3. 에탄올 내성 검정

벌꿀 섭취가 에탄올 내성에 미치는 영향을 평가하기 위하여 에탄올 증기 노출 실험을 수행하였다. 에탄올(Sigma-Aldrich Co., St. Louis, MO, USA) 농도는 5~30% (v/v) 범위에서 2.5% 간격으로 설정하였으며, 에탄올 무처리 조건을 대조구로 포함하였다. 각 처리구마다 3~5일령 성충 암컷 초파리 10마리를 5 mL 투명 유리 바이알에 접종하였다.

바이알 마개 내부에 면봉을 삽입한 후 에탄올 200 μL를 점적하여 증기화되도록 하였으며, 에탄올과 초파리의 직접 접촉을 방지하기 위해 거즈로 밀봉하였다(Kim et al., 2018). 에탄올 증기 농도를 일정하게 유지하기 위해 2시간 간격으로 새로운 면봉에 동일한 양의 에탄올을 재점적하였고, 총 노출 시간은 8시간으로 설정하였다. 생존율은 노출 시작 후 1시간 간격으로 조사하였으며, 더듬이나 다리의 미세한 움직임이 확인될 경우 생존 개체로 판정하였다.

4. 유전자 발현 분석용 시료 채집

에탄올 내성 실험 결과를 바탕으로, 벌꿀 처리군과 대조군 간 생존율 차이가 뚜렷하게 나타난 25% 에탄올 조건을 유전자 발현 분석에 사용하였다. 에탄올 노출 후 0, 1, 2, 4 및 6시간 시점에서 생존 개체를 채집하였으며, 각 시점마다 생존 개체 3마리를 혼합하여 하나의 시료로 사용하였고, 총 3반복으로 실험하였다. 채집된 시료는 즉시 -80℃에서 동결하여 유전자 분석 전까지 보관하였다.

5. RNA 추출 및 qRT-PCR 분석

총 RNA는 TRI Reagent® (Zymo Research, Irvine, CA, USA)를 이용하여 추출하였으며, DNase I 처리를 통해 게놈 DNA를 제거하였다. cDNA 합성은 총 RNA 1 μg을 주형으로 하여 oligo (dT) primer를 사용해 수행하였다(Toyobo, Osaka, Japan). qRT-PCR은 SYBR Green 기반으로 수행하였으며(Bio-Rad, Hercules, CA, USA), 기준 유전자(reference gene)로는 RPL18을 사용하였다. 분석 대상 유전자는 알코올 대사 관련 유전자(Adh, Aldh), 항산화 관련 유전자(SOD1, SOD2, CAT, Trxr1, GstD2, GstD5) 및 항균펩타이드 유전자(DptA, DptB, AttC, Mtk)로 구성하였으며, 각 유전자 증폭을 위한 정보는 Table 1에 제시하였다.

Information of primers and amplicons in D. melanogaster for qRT-PCR assay in this study

6. 통계 분석

모든 실험 결과는 평균±표준오차(mean±SEM)로 나타내었다. 처리군과 대조군 간 차이는 반복측정 일반선형모형(GLM repeated measures ANOVA)을 이용하여 분석하였으며, 통계적 유의성은 p<0.05 수준에서 판단하였다.


결 과

1. 벌꿀 섭취에 따른 에탄올 내성 변화

처리한 에탄올 농도가 높아짐에 따라 대조군과 벌꿀 처리군 초파리 모두 생존율이 점차 감소하는 경향을 보였으며, 벌꿀 처리군은 대부분의 에탄올 농도 조건에서 대조군보다 높은 생존율을 보였다(Fig. 1). 특히 12.5% 이상의 에탄올 조건에서 벌꿀 처리군은 노출 초기 시간대에서 생존율 감소가 완만하게 나타났으며, 이는 벌꿀 섭취가 급성 화학적 스트레스에 대한 초기 방어 능력을 향상시켰음을 시사한다. 25% 에탄올 조건에서는 초기 생존율 차이가 뚜렷하였으나, 장시간 노출 시 두 군 간 생존율 차이는 점차 감소하였다(Fig. 1J). 30% 에탄올을 처리하였을 때, 대조군보다 벌꿀을 섭취한 파리에서의 생존율이 뚜렷하게 높게 나타났으며, 전체 에탄올 처리 조건들 중 유일하게 통계적 유의성을 보였다(p=0.032, Fig. 1L).

Fig. 1.

Comparison of survival rates of Drosophila melanogaster reared on a diet containing honey and exposed to various concentrations of ethanol (5~30%). Survival rates were monitored for 8 h after ethanol exposure. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

2. 알코올 대사 관련 유전자 발현

다양한 농도의 에탄올 처리 실험 중 30% 에탄올 노출 실험에서 벌꿀 섭취 초파리의 생존율이 일반 배지에서 성장한 초파리보다 통계적으로 유의미하게 높았으나, 두 조건의 초파리의 높은 사충으로 인해 유전자 발현 분석을 위한 생존 개체수가 충분히 확보되지 못하였다(Fig. 1L). 벌꿀을 포함한 배지와 일반 배지에서 각각 성장한 초파리의 생존율의 차이가 나타나기 시작하고 유전자 발현 분석을 위한 충분한 개체수가 확보 가능한 25% 에탄올 처리 조건을 선정하였다(Fig. 1J). 각 배지에서 성장한 초파리를 25% 에탄올에 노출한 후 6시간 동안 알코올 대사 및 항산화 관련 유전자의 발현 양상을 분석하였다. 벌꿀 처리군에서 알코올 대사 관련 유전자인 AdhAldh 발현은 전반적으로 대조군보다 낮았으나 유의한 차이를 보이지 않았다(Fig. 2). Adh의 경우 에탄올 노출 1시간 후 벌꿀 처리군에서 일시적으로 상승하였으나, 이후 6시간 동안 감소하는 경향을 보였다(Fig. 2A). 대조군에서의 Aldh의 발현량은 에탄올 노출 1시간 후부터 급격하게 증가하는 경향을 보이는 반면, 벌꿀 처리군에서는 에탄올 노출 후 발현량의 변화가 나타나지 않았다(Fig. 2B). 이는 대조군에서는 알코올 대사와 관련된 생리학적 변화가 진행되고 있음을 시사하는 반면 벌꿀 처리군에서는 상대적으로 알코올 대사 경로가 활성화되지 않은 상태임을 반영하는 것으로 생각된다.

Fig. 2.

Expression patterns of genes involved in alcohol metabolism in Drosophila melanogaster reared on an artificial diet containing honey after exposure to 25% ethanol: (A) alcohol dehydrogenase and (B) aldehyde dehydrogenase. Gene expression levels were normalized to RPL18. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

3. 항산화 관련 유전자 발현

항산화 관련 유전자(SOD1, SOD2, GstD2, GstD5, CAT, Trxr1)의 경우, GstD2를 제외하고 대체적으로 대조군에서는 에탄올 노출 후기 시간대에 급격한 발현 증가가 관찰된 반면, 벌꿀 처리군에서는 상대적으로 낮고 안정적인 발현 양상을 보였다(Fig. 3). 특히 대조군에서의 SOD1GsD5, Trxr1은 에탄올 노출 4시간 이후 급격한 발현 증가가 관찰되었고(Fig. 3A, D, F), SOD2, CAT은 노출 2시간 후부터 그 발현량의 지속적 증가가 관찰되었다(Fig. 3B, E). 이들 항산화 관련 유전자들의 발현량 증가는 대조군에서의 에탄올 노출에 따른 산화스트레스에 대한 생리학적 대응에 따른 것이라 판단된다. 반면 벌꿀 처리군에서의 항산화 관련 유전자들의 안정적인 발현 양상은 초파리 체내 산화스트레스가 대조군에 비해 높지 않은 상태를 대변하는 것이라 사료된다.

Fig. 3.

Expression patterns of genes involved in antioxidant responses in Drosophila melanogaster reared on an artificial diet containing honey after exposure to 25% ethanol: (A) superoxide dismutase 1, (B) superoxide dismutase 2, (C) glutathione S-transferase D2, (D) glutathione S-transferase D5, (E) catalase, and (F) thioredoxin reductase 1. Gene expression levels were normalized to RPL18. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

4. 항균펩타이드 유전자 발현

벌꿀 처리군에서는 에탄올 노출 이전 시점부터 DptA, DptB, AttCMtk의 발현이 전반적으로 대조군보다 높게 나타났다(Fig. 4). 특히 DptAAttC는 전 시간대에서 유의적으로 높은 발현을 유지하였으며(Fig. 4A, C), DptB, AttC, Mtk는 에탄올 노출 2시간 후 그 발현량이 가장 높은 동일한 특징을 보였다(Fig. 4B, C, D). 대체적으로 벌꿀 처리군에서의 에탄올 노출 전부터 높은 항균펩타이드 발현을 유지하는 현상은 벌꿀 섭취가 면역 반응을 사전에 활성화함으로써 화학적 스트레스에 대한 대비 상태를 형성했음을 시사한다.

Fig. 4.

Expression patterns of genes encoding antimicrobial peptides in Drosophila melanogaster reared on an artificial diet containing honey after exposure to 25% ethanol: (A) diptericin A, (B) diptericin B, (C) attacin C, and (D) metchnikowin. Gene expression levels were normalized to RPL18. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.


고 찰

본 연구는 벌꿀 섭취가 초파리의 에탄올 유도 화학적 스트레스 내성을 유의적으로 향상시킨다는 점을 확인하고, 그 분자적 기작을 유전자 발현 수준에서 규명하였다. 특히 에탄올 내성 증가가 전통적으로 알려진 알코올 대사 효소인 AdhAldh의 발현 증가와 직접적으로 연관되지 않았다는 점은 주목할 만하다.

AdhAldh는 각각 에탄올을 아세트알데하이드로, 아세트알데하이드를 카복실산으로 전환하는 핵심 효소로 알려져 있으나(Zakhari, 2006), 이들 효소의 과도한 활성은 독성 중간산물 축적과 활성산소종 증가를 초래할 수 있다. 실제로 Adh 발현 증가가 초파리의 수명 단축 및 스트레스 민감성과 연관될 수 있음이 보고된 바 있다(Logan-Garbisch et al., 2015). 본 연구에서 벌꿀 처리군에서 AdhAldh 발현이 억제되거나 큰 변화가 없었던 점은, 벌꿀에 의해 유도된 에탄올 내성이 알코올 대사 경로의 과도한 활성화 없이 획득되었음을 시사한다(Fig. 2).

항산화 관련 유전자 발현 양상 역시 이러한 해석을 지지한다. 항산화 효소인 SOD, CAT, Trxr1는 활성산소종 제거와 산화- 환원 항상성 유지에 중요한 역할을 수행한다(Ighodaro and Akinloye, 2018). 본 연구에서 대조군은 에탄올 노출 후기 시간대에 이들 유전자의 발현이 급격히 증가한 반면, 벌꿀 처리군에서는 상대적으로 낮고 안정적인 발현 양상이 유지되었다(Fig. 4). 이는 에탄올 노출에 의한 대조군에서 산화적 스트레스가 누적됨에 따라 보상적 항산화 반응이 유도된 결과로 해석될 수 있다. 외인성 항산화 물질의 공급이 내인성 항산화 유전자 발현을 억제할 수 있다는 기존 연구 결과를 고려할 때(Imraish et al., 2024), 본 연구에서 관찰된 벌꿀 처리군의 항산화 유전자 발현 억제 양상은 벌꿀에 포함된 항산화 성분이 세포 내 산화적 부담을 직접 완화했을 가능성을 시사한다.

그러나 벌꿀 처리군에서 관찰된 에탄올 내성 증가를 알코올 대사 경로와 항산화 작용으로 설명하기에는 한계가 있다. 본 연구에서 가장 두드러진 변화는 항균펩타이드 유전자의 조기 및 지속적 발현 증가였다(Fig. 4). 항균펩타이드는 IMD 및 Toll 신호전달 경로를 통해 조절되며, 병원체 방어뿐 아니라 화학적 스트레스 조건에서도 생존에 기여할 수 있음이 보고되어 왔다(Lemaitre and Hoffmann, 2007; Kim et al., 2022; Tian et al., 2025). 특히 초파리가 서식하는 환경에서 주로 발생하는 2-phenylethanol, 에탄올과 아세트산 노출 시 Toll 신호 경로에 의해 발현이 조절되는 항균펩타이드보다는 IMD 신호 경로와 관여되는 항균펩타이드의 발현량이 유의미하게 증가하는 경향을 보였는데(Kim et al., 2022), 이를 통해 초파리의 화학물질 내성에 IMD 경로가 더 중요한 생리학적 기능을 할 것으로 판단된다. 또한 IMD 신호 경로의 전사인자인 Relish의 발현 억제 형질전환 초파리에서의 화학물질 내성도 감소 현상(Kim et al., 2022)을 비롯한 본 연구에서 관찰된 벌꿀 처리군에서의 IMD 신호 경로에 속하는 항균펩타이드의 발현량 증가(Fig. 4)와 에탄올 내성도 증가(Fig. 1)는 IMD 매개 항균펩타이드 발현과 화학물질 내성과의 높은 상관성을 검증한 결과라 여겨진다. 또한 벌꿀 처리군에서 항균펩타이드 유전자가 에탄올 노출 이전부터 상향 조절된 점은, 벌꿀 섭취가 초파리의 면역계를 사전에 활성화된 ‘프라이밍(priming)’ 상태로 전환시켰음을 의미한다. 이러한 면역 기반 스트레스 대응 전략은 에탄올 노출 이후 항산화 및 대사 경로를 급격히 활성화하는 방식보다 생리적 부담이 적은 효율적인 방어 기작일 가능성이 제시된다.

종합하면, 본 연구에서 관찰된 벌꿀 섭취에 의한 에탄올 내성 증가는 알코올 대사 효소 활성 증가나 항산화 유전자 발현의 과도한 상향 조절에 의존하지 않았으며, 항균펩타이드 유전자의 조기 활성화를 중심으로 한 면역 기반 스트레스 적응 전략에 의해 매개된 것으로 판단된다. 이러한 결과는 벌꿀이 면역·대사·항산화 경로를 통합적으로 조절할 수 있는 기능성 양봉 산물임을 초파리 모델을 통해 분자 수준에서 입증한 사례로서 의의를 갖는다.


적 요

벌꿀은 항산화, 해독 및 면역 조절 기능을 지닌 대표적인 양봉 산물로 알려져 있으나, 곤충을 대상으로 벌꿀 섭취가 화학적 스트레스 내성과 관련된 분자적 기작에 미치는 영향은 충분히 규명되지 않았다. 본 연구는 벌꿀 섭취가 초파리 (Drosophila melanogaster)의 에탄올 유도 화학적 스트레스 내성과 관련 유전자 발현에 미치는 영향을 규명하고자 수행되었다. 성충 암컷 초파리를 벌꿀을 첨가한 인공 사료로 전 생애 동안 사육한 후, 다양한 농도의 에탄올 증기에 노출하여 시간대별 생존율을 비교하였다. 또한 에탄올 노출 후 생존 개체를 대상으로 알코올 대사 관련 유전자 (Adh, Aldh), 항산화 관련 유전자 (SOD1, SOD2, CAT, Trxr1, GstD2, GstD5) 및 항균펩타이드 유전자 (DptA, DptB, AttC, Mtk)의 발현 변화를 qRT-PCR을 통해 분석하였다. 그 결과, 벌꿀 처리군은 대조군에 비해 전반적으로 높은 에탄올 내성을 보였으며, 특히 중·고농도 에탄올 조건에서 노출 초기 시간대의 생존율이 유의적으로 향상되었다. 유전자 발현 분석 결과, 알코올 대사 관련 유전자의 발현 증가는 관찰되지 않았으나, 항균펩타이드 유전자는 에탄올 노출 이전부터 유의적으로 상향 조절되었다. 항산화 관련 유전자는 대조군에서 에탄올 노출 후기 시간대에 급격히 증가한 반면, 벌꿀 처리군에서는 상대적으로 낮고 안정적인 발현 수준을 유지하였다. 이상의 결과는 벌꿀 섭취가 알코올 대사 효소 활성 증가보다는 면역 반응의 사전 활성화와 산화적 스트레스 완화를 통해 화학적 스트레스 내성을 증진시킬 수 있음을 시사하며, 벌꿀의 기능성 생리 효과에 대한 분자적 근거를 제공한다.

Acknowledgments

본 연구는 한국정부(과학기술정보통신부)의 지원을 받아 한국연구재단의 연구비 지원(2023R1A2C1005546)으로 수행되었습니다. 본 논문은 차주헌의 석사 학위 논문에 기반하여 작성되었습니다.

References

  • Ball, D. W. 2007. The chemical composition of honey. J. Chem. Educ. 84: 1643. [https://doi.org/10.1021/ed084p1643]
  • Chandler, J. A., J. A. Eisen and A. Kopp. 2012. Yeast communities of diverse Drosophila species: Comparison of two symbiont groups in the same hosts. Appl. Environ. Microbiol. 78: 7327-7336. [https://doi.org/10.1128/AEM.01741-12]
  • Dalton, D. T., V. M. Walton, P. W. Shearer, D. B. Walsh, J. Caprile and R. Isaacs. 2011. Laboratory survival of Drosophila suzukii under simulated winter conditions of the Pacific Northwest and seasonal field trapping in five primary regions of small and stone fruit production in the United States. Pest Manag. Sci. 67: 1368-1374. [https://doi.org/10.1002/ps.2280]
  • Ighodaro, O. and O. Akinloye. 2018. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 54: 287-293. [https://doi.org/10.1016/j.ajme.2017.09.001]
  • Imraish, A., T. A. Thiab, M. Zihlif and A. Al-Hunaiti. 2024. Anti-inflammatory and antioxidant potential of green synthesized iron zinc oxide (Fe0. 25-ZnO) nanoparticles of the Elaeagnus angustifolia. Chem. Biodivers. 21: e202401060. [https://doi.org/10.1002/cbdv.202401060]
  • Jennings, B. H. 2011. Drosophila - a versatile model in biology & medicine. Mater. Today 14: 190-195. [https://doi.org/10.1016/S1369-7021(11)70113-4]
  • Kim, Y., G. Goh and Y. H. Kim. 2022. Expression of antimicrobial peptides associated with different susceptibilities to environmental chemicals in Drosophila suzukii and Drosophila melanogaster. Pest. Biochem. Physiol. 187: 105210. [https://doi.org/10.1016/j.pestbp.2022.105210]
  • Kim, Y. H., D. H. Kwon, H. M. Ahn, Y. H. Koh and S. H. Lee. 2014. Induction of soluble AChE expression via alternative splicing by chemical stress in Drosophila melanogaster. Insect Biochem. Mol. Biol. 48: 75-82. [https://doi.org/10.1016/j.ibmb.2014.03.001]
  • Kim, Y., S. Lee, Y. H. Kim and Y. H. Kim. 2018. Comparative analyses of susceptibility to chemicals associated with fermentation between Drosophila melanogaster and Drosophila suzukii. Entomol. Res. 48: 514-521. [https://doi.org/10.1111/1748-5967.12326]
  • Kim, Y., Y. Kim and Y. H. Kim. 2020. Evaluation of reference genes for gene expression studies using quantitative real-time PCR in Drosophila melanogaster after chemical exposures. J. Asia-Pac. Entomol. 23: 385-394. [https://doi.org/10.1016/j.aspen.2020.01.008]
  • Lemaitre, B. and J. Hoffmann. 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25: 697-743. [https://doi.org/10.1146/annurev.immunol.25.022106.141615]
  • Logan-Garbisch, T., A. Bortolazzo, P. Luu, A. Ford, D. Do, P. Khodabakhshi and R. L. French. 2015. Developmental ethanol exposure leads to dysregulation of lipid metabolism and oxidative stress in Drosophila. G3 (Bethesda). 5: 49-59. [https://doi.org/10.1534/g3.114.015040]
  • Roberts, D. B. 2006. Drosophila melanogaster: The model organism. Entomol. Exp. Appl. 121: 93-103. [https://doi.org/10.1111/j.1570-8703.2006.00474.x]
  • Santos-Buelga, C. and A. M. González-Paramás. 2025. Chemical composition of honey. pp. 47-104. in Bee Products - Chemical and Biological Properties. Springer. Switzerland. [https://doi.org/10.1007/978-3-031-89049-9_3]
  • Seong, K. M., Y. Kim, D. Kim, B. R. Pittendrigh and Y. H. Kim. 2020. Identification of transcriptional responsive genes to acetic acid, ethanol, and 2-phenylethanol exposure in Drosophila melanogaster. Pest. Biochem. Physiol. 165: 104552. [https://doi.org/10.1016/j.pestbp.2020.02.018]
  • Stotzky, G., S. Schenck and G. C. Papavizas. 1976. Volatile organic compounds and microorganisms. Crit. Rev. Microbiol. 4: 333-382. [https://doi.org/10.3109/10408417609102303]
  • Tian, Y., X. Yue, R. Jiao, M. A. Hanson and B. Lemaitre. 2025. Functional characterization of Paillotin: An immune peptide regulated by the Imd pathway with pathogen-specific roles in Drosophila immunity. bioRxiv. 2025. 2005. 2012.653313. [https://doi.org/10.1101/2025.05.12.653313]
  • Zakhari, S. 2006. Overview: How is alcohol metabolized by the body? Alcohol Res. Health 29: 245. [https://doi.org/10.1159/000095013]
  • Zwaan, B., R. Bijlsma and R. Hoekstra. 1991. On the developmental theory of ageing. I. Starvation resistance and longevity in Drosophila melanogaster in relation to pre-adult breeding conditions. Heredity 66: 29-39. [https://doi.org/10.1038/hdy.1991.4]

Fig. 1.

Fig. 1.
Comparison of survival rates of Drosophila melanogaster reared on a diet containing honey and exposed to various concentrations of ethanol (5~30%). Survival rates were monitored for 8 h after ethanol exposure. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

Fig. 2.

Fig. 2.
Expression patterns of genes involved in alcohol metabolism in Drosophila melanogaster reared on an artificial diet containing honey after exposure to 25% ethanol: (A) alcohol dehydrogenase and (B) aldehyde dehydrogenase. Gene expression levels were normalized to RPL18. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

Fig. 3.

Fig. 3.
Expression patterns of genes involved in antioxidant responses in Drosophila melanogaster reared on an artificial diet containing honey after exposure to 25% ethanol: (A) superoxide dismutase 1, (B) superoxide dismutase 2, (C) glutathione S-transferase D2, (D) glutathione S-transferase D5, (E) catalase, and (F) thioredoxin reductase 1. Gene expression levels were normalized to RPL18. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

Fig. 4.

Fig. 4.
Expression patterns of genes encoding antimicrobial peptides in Drosophila melanogaster reared on an artificial diet containing honey after exposure to 25% ethanol: (A) diptericin A, (B) diptericin B, (C) attacin C, and (D) metchnikowin. Gene expression levels were normalized to RPL18. Statistical analysis was performed using a GLM repeated-measures ANOVA (p<0.05). Data are presented as mean±SE.

Table 1.

Information of primers and amplicons in D. melanogaster for qRT-PCR assay in this study

Categories Gene Primers Amplicons Reference
Symbol Full gene name Sequence (5ʹ → 3ʹ) Size
(bp)
GC
(%)
Tm
(℃)
Size
(bp)
GC
(%)
R2 Efficiency
(%)
Alcohol
metabolism
Adh Alcohol
dehydrogenase
For. GCGAAACTGGCCCCCATTAC 20 60 62.5 175 62.3 0.996 92.1 This study
Rev. CCTTGACGAAGTTCTCGGCG 20 60 62.5
Aldh Aldehyde
dehydrogenase
For. AGAAGCGCACCGTGGGCAAT 20 60 62.5 134 52.2 0.995 92.9 This study
Rev. GCCACCGGCAACCAACTTAG 20 60 62.5
Antioxidant
related
SOD1 Superoxide
dismutase1
For. CCCACCAAGGTCAACATCACC 21 57.1 63.2 138 60.1 0.997 93.38 This study
Rev. GTTGCCCGTTGACTTGCTCAG 21 57.1 63.2
SOD2 Superoxide
dismutase2
For. AAAGGAGCTGACCACGCTGAC 21 57.1 63.2 181 65.2 0.993 92.38 This study
Rev. CTGCAGATAGTAGGCGTGCTC 21 57.1 63.2
CAT Catalase For. CGGGATGGAGCCATGAATGTG 21 57.1 63.2 131 61 0.995 90.1 This study
Rev. ACATCTCCAGTCACCGGACAG 21 57.1 63.2
Trxr1 Thioredoxin
reductase-1
For. CAGTTCGGAGCCGATGAGATC 21 57.1 63.2 132 58.3 0.994 91.69 This study
Rev. ATAGACGCGCTGGTCACCATG 21 57.1 63.2
GstD2 Glutathione S
transferase D2
For. TCCACAGCACACCATTCCCAC 22 50 62.1 165 57 0.992 96.9 This study
Rev. CCCATGTCGAAGTACAGACGC 21 57.1 63.2
GstD5 Glutathione S
transferase D5
For. TGGTGGAGAAGTACGGCAAGG 21 57.1 63.2 223 49.8 0.991 90.8 This study
Rev. TAGTTCTGGCCCTCCAGGAAG 21 57.1 63.2
Antimicrobial
peptides
DptA Diptericin A For. TTACTTTGCTGCGCAATCGCTT 22 45 60.1 213 56.3 0.9915 90.73 Kim et al., 2022
Rev. TCCATATCCTCCATTCAGTCCA 22 45 60.1
DptB Diptericin B For. GTGCGTCGCCAGTTCCAATTG 21 57 63.2 121 59.5 0.9967 92.62 Kim et al., 2022
Rev. CATCGAAGGAGTGGCGTCCAT 21 57 63.2
AttC Attacin-C For. CCTCGCAGAATCAGCTTGCCA 21 57 63.2 136 51.5 0.9954 91.63 Kim et al., 2022
Rev. CCCAGCTCCAATTGCTTACCC 21 57 63.2
Mtk Metchnikowin For. GCGATTTTTCTGGCCCTGCTG 21 57 63.2 115 68.3 0.9996 94 Kim et al., 2022
Rev. GGTTAGGATTGAAGGGCGACG 21 57 63.2
Reference rpl 18 ribosomal
protein L18
For. GCAAGCCAGCACTGAATACG 20 55 60.1 197 51.8 0.9999 92.95 Kim et al., 2020
For. TGCTGGCACTCAGGATGGTT 20 55 60.1