The APICULTURAL SOCIETY OF KOREA
[ Original research article ]
Journal of Apiculture - Vol. 41, No. 1, pp.43-53
ISSN: 1225-0252 (Print)
Print publication date 30 Apr 2026
Received 15 Mar 2026 Revised 05 Apr 2026 Accepted 07 Apr 2026
DOI: https://doi.org/10.17519/apiculture.2026.04.41.1.43

재래꿀벌(Apis cerana) 봉군에서 검출된 꿀벌응애류(Varroa spp.)의 형태 및 mtDNA 기반 종 동정

김진명 ; 오대근 ; 김윤희 ; 이창훈 ; 아콩테 피터 ; 최용수 ; 김종원1 ; 김동원*
국립농업과학원 농업생물부 양봉과
1경남농업기술원 그린바이오연구소
Morphological and mtDNA-based Characterization of Varroa Mites Detected in Apis cerana Colonies
Jin Myung Kim ; Daegeun Oh ; Yun Hui Kim ; Chang-hoon Lee ; Peter Nijukang Akongte ; Yong-Soo Choi ; Jongwon Kim1 ; Dongwon Kim*
Department of Agricultural Biology, Honeybee Resource Materials Research Laboratory, National Institute of Agricultural Sciences, Wanju 55365, Republic of Korea
1Green Bio Research Institute, Gyeongsangnam-do Agricultural Research & Extension Servieces, Jinju 52733, Republic of Korea

Correspondence to: *E-mail: dongwonkim@korea.kr

Abstract

The eastern honeybee (Apis cerana) typically maintains low mite infestation levels due to its robust hygienic behavior, which limits the reproductive success of parasitic mites. However, the recent detection of mites in Korean A. cerana colonies has necessitated a precise taxonomic evaluation. This study aimed to identify and compare the mites collected from A. cerana and A. mellifera colonies using morphological and mitochondrial DNA (mtDNA) analysis. Morphological examination of key diagnostic characters showed no significant differences between the mites from the two host species, with all specimens conforming to the established characteristics of Varroa destructor. Molecular analysis of the cytochrome oxidase I (COI) and ATP synthase subunit 6-cytochrome c oxidase subunit 3 (ATP6-COX3) regions further confirmed this identification. While the COI sequences were identical to the reference V. destructor, the ATP6-COX3 region exhibited minor nucleotide variations (99.25~99.55% similarity). Phylogenetic analysis demonstrated that all samples clustered within the Korean haplotype (K-type) V. destructor clade, the predominant haplotype. These results confirm that the mites detected in A. cerana andA. mellifera colonies belong to the same genetic lineage, suggesting a high potential for interspecies transmission between the two hosts. Further studies should be conducted to evaluate whether these mites can establish stable reproductive populations within A. cerana colonies.

Keywords:

Honeybee, Varroa destructor, Host, Korean haplotype, mtDNA

서 론

꿀벌 기생성 응애류는 전 세계적으로 양봉 산업에 가장 심각한 피해를 유발하는 외부기생성 해충이다(Cox-Foster et al., 2007; Kim, 2022). 약 40여 종에 달하는 다양한 응애류가 꿀벌에 기생하는 것으로 알려져 있으며, 대표적으로는 외부기생성인 꿀벌응애(Varroa destructor)와 중국가시응애(Tropilaelaps mercedesae), 내부기생성인 기문응애(Acarapis woodi)가 알려져 있다(Choi et al., 2014; Kim et al., 2019). Varroa속의 주요 종으로는 V. jacobsoni, V. destructor, V. underwoodiV. rindereri가 있는데(Rosenkranz et al., 2010), 꿀벌응애(V. destructor)는 전 세계적으로 분포하는 반면 다른 일부 종은 국지적으로 분포한다. 꿀벌응애(V. destructor)는 총 6개의 haplotype이 보고되어 있으며, 양봉꿀벌(Apis mellifera)에 기생하는 꿀벌응애는 Korean haplotype (K-type)과 Japan-Thailand haplotype (J-type)이다. 이 중 K-type은 전 세계에 광범위하게 분포하는 반면, J-type은 아시아 지역에 제한적으로 분포하는 것으로 보고되었다(Anderson and Trueman, 2000; Park and Lee, 2004; Akinwande et al., 2012). 특히 K-type은 양봉꿀벌에서 높은 번식 성공률과 개체군 확산력을 보이는 haplotype으로, 이는 전 세계적 피해 확산과 밀접하게 관련되어 있다. 이러한 haplotype 간 차이는 단순한 유전적 변이뿐 아니라 병원성, 번식 특성 및 기주 적응성과도 연관될 수 있다(Beaurepaire et al., 2019; Lin et al., 2021).

꿀벌응애 원기주는 재래꿀벌(Apis cerana)이었으나, 20세기 중반 이후 양봉꿀벌(A. mellifera)로의 기주이전(host shift)이 발생해 전 세계적으로 확산되었다(Oldroyd, 1999; Anderson and Trueman, 2000; van Alphen and Fernhout, 2020; Grindrod and Martin, 2023). 이러한 급격한 확산은 산업화에 따른 이동수단의 발달 등으로 활발해진 봉군 이동이 원인으로 지목되었다. 원기주인 재래꿀벌은 감염된 번데기를 제거하는 청소행동(hygienic behavior)과 응애 번식을 제한하는 행동적·생리적 기작을 통해 응애 개체군의 급격한 증식을 효과적으로 억제한다(Peng et al., 1987; Rath, 1999; Grindrod and Martin, 2023). Ji et al. (2014)은 꿀벌응애에 감염된 A. cerana에서 그루밍 및 청소행동과 관련된 유전자 발현 변화가 나타남을 보고하였으며, 이러한 반응이 응애 저항성과 관련될 가능성을 제시하였다. 또한 Lin et al. (2018)은 두 기주 간에 꿀벌응애 번식 성공률의 현저한 차이를 보고하였다. 이는 원기주인 A. cerana 번데기 발달 속도가 V. destructor의 자손 성숙 시기와 일치하지 않기 때문으로, 그 결과 자손이 충분히 성숙하기 전에 벌이 우화하며 번식이 실패하게 된다. 반면 양봉꿀벌에서는 재래꿀벌과 같은 방어 기작이 충분히 발달하지 않아 응애 번식 성공률이 높게 나타나며, 이에 따라 개체군이 단기간에 급격히 증가하여 심각한 봉군 피해를 초래한다(Boot et al., 1992; Rosenkranz et al., 2010). 국내의 꿀벌 종에 따른 질병 발생 조사에서 역시 꿀벌응애는 양봉꿀벌에서 높은 빈도로 확인되는 반면, 재래꿀벌은 별도의 응애 발생 보고 없이 꿀벌응애에 대한 저항성을 가진다는 언급에 그쳤다(Kang et al., 2012). 그러나 최근 국내의 일부 재래꿀벌 봉군에서 다수의 꿀벌응애가 검출되면서 기존의 인식과는 다른 양상이 확인되었다. 이는 단순한 일시적 침입인지, 실제로 재래꿀벌 내에서 번식 가능한 개체군이 형성된 것인지에 대한 명확한 검증이 필요함을 의미한다. 국내에서 발견되는 V. destructor는 주로 K-type으로 보고되어 왔으나(Park and Lee, 2004), 기주 종이나 환경 조건에 따른 변이가 나타날 가능성을 배제할 수 없다. 실제로 꿀벌응애는 지역, 기후 및 기주 조건에 따라 외형적 형질에서 유의미한 변이를 보일 수 있음이 보고된 바 있다(Dadgostar and Nozari, 2018). 이러한 변이는 동일 종 내에서도 나타날 수 있어 단순한 형태적 분석만으로 개체군 간 분류학적 동일성을 판단하는 데 한계가 있으며, 보다 명확한 규명을 위해 분자유전학적 분석을 병행하는 연구가 증가하고 있다. mtDNA는 종 동정 및 계통 구분에 널리 활용되는 분자 표지자로, 특히 cytochrome oxidase I (COI)를 비롯하여 ATP synthase subunit 6 (ATP6) 및 cytochrome b (CYTB) 등의 마커가 꿀벌응애 집단 간/집단 내 변이를 분석하는 데 사용되어 왔다(Solignac et al., 2005; Navajas et al., 2010). 대표적인 예로 과거 단일 종으로 인식되던 V. jacobsoni가 분자계통학적 분석을 통해 V. destructor로 재분류되었으며, V. destructor 내 haplotype의 차이 또한 밝혀진 바 있다(Anderson and Trueman, 2000; Navajas et al., 2010). 이러한 점은 꿀벌응애 개체군의 분류학적 동일성 평가에 있어 mtDNA 기반 분석이 중요한 역할을 할 수 있음을 시사한다.

양봉꿀벌로의 기주이전 후 재래꿀벌 봉군에서 다시금 많은 수의 응애가 검출되는 현상은 봉군 관리 및 방제 전략 수립 측면에서 중요한 의미를 가지나, 국내 재래꿀벌에서 검출된 응애의 유전적 계통 및 분류학적 위치에 대해서는 충분히 검증되지 않았다. 이러한 종 동정에 대한 정보는 적절한 방제 시기와 방법을 설정하고, 확산 위험을 평가하기 위한 기초 자료로 활용될 수 있다. 따라서 본 연구에서는 국내 재래꿀벌과 양봉꿀벌 봉군에서 각각 채집된 응애를 대상으로 체장 및 체폭, 생식기덮개 길이 및 너비, 항문덮개 길이 및 너비의 형태적 특성을 비교하고, mtDNA cytochrome oxidase I (COI) 유전자와 ATP synthase sub-unit 6 - cytochrome c oxidase subunit 3 (ATP6-COX3) 영역의 염기서열 분석을 수행하여 동일 종 여부를 확인하고자 하였다.


재료 및 방법

1. 시료 채취 및 형태 측정

재래꿀벌 3봉군으로부터 자연 낙하한 응애를 채집하였다(AcV). 채집은 경남농업기술원 그린바이오 연구소 실험양봉장에서 수행되었으며, 해당 장소는 재래꿀벌과 양봉꿀벌이 동시에 사양 관리되고 있다. 두 양봉장은 약 100 m 떨어져 위치해 있다. 재래꿀벌에서 채집된 꿀벌응애류와 비교를 위해 양봉꿀벌에서 꿀벌응애(V. destructor)를 채집하였다(AmVd). 양봉꿀벌은 국립농업과학원 양봉장에서 관리 중인 봉군을 사용하였으며 꿀벌응애는 가루설탕법(Kim and Jung, 2008)을 사용해 채집되었다. 채집된 꿀벌응애는 모두 Leica microscope MSV266 (Leica, Wetzlar, Germany)에 결합된 Tuscan Mosaic 2.2.1 Software (Tuscan, Fuzhou, Fujian Province, China)를 사용해 등면(dorsal view)과 배면(ventral view)을 촬영하였다(AmVd, n=50; AcV-1, n=28; AcV-2, n=75; AcV-3, n=17). 꿀벌응애 형태 측정은 Kesik et al. (2025)를 참조하였으며, 체장 및 체폭을 포함하여 생식기덮개와 항문덮개 각각의 길이 및 너비를 측정하였다.

2. genomic DNA (gDNA) 분리 및 중합효소 연쇄반응 (Polymerase chain reaction; PCR)

형태 측정이 완료된 개체 중 각 그룹(AmVd, AcV-1, 2, 3)에서 무작위로 5마리를 선별하여 각각 genomic DNA(gDNA)를 분리하였다. gDNA는 Wizard® genomic DNA purification kit (Promega, Madison, WI, USA)를 사용하여 제조사의 지침에 따라 분리되었다. 분리된 gDNA의 농도 및 순도는 VivaSpec Spectrophotometer(Sartorius, Gottingen, Germany)를 사용해 측정하였다.

mtDNA 분석을 위해 cytochrome oxidase I (COI) 유전자와 ATP synthase membrane subunit 6 - cytochrome c oxidase subunit 3 (ATP6-COX3) 영역을 표적으로 하는 프라이머를 사용하였으며, 프라이머 서열은 Table 1에 제시하였다. PCR은 AccuPower® HotStart PCR PreMix (BIONEER, Yuseong-gu, Daejeon, Republic of Korea)를 이용해 총 반응액 20 μL에서 수행하였으며, 각 반응에는 50 ng의 gDNA와 10 pmol의 프라이머를 사용하였다. PCR 조건은 94℃에서 5분간 초기 변성 후, 94℃ 30초, 55℃ 30초, 72℃ 45초를 35회 반복하고, 72℃에서 5분간 최종 신장을 수행하였다. 증폭 산물은 1% agarose gel 전기영동을 통해 증폭 및 단일 밴드 형성 여부를 확인하였다.

Primer sequences used in this study

3. mtDNA 염기서열 분석 및 alignment

확인된 PCR 산물은 Wizard® SV Gel and PCR Clean-Up System (Promega)을 사용하여 제조사의 지침에 따라 정제되었다. 이후 10× loading buffer (Takara Bio Inc, Shiga, Japan)와 혼합한 뒤 1% agarose gel에서 밴드 유무를 확인하였다. 정제된 PCR 산물은 Sanger sequencing을 위해 Macrogen INC. (Geumcheon-gu, Seoul, Korea)에 분석 의뢰하였다. 확보된 염기서열은 BioEdit software (Ibis Biosciences, Carlsbad, CA, USA)를 사용해 검토하고 양쪽 말단을 정리하였다. 이후 NCBI nucleotide BLAST(https://blast.ncbi.nlm.nih.gov/Blast.cgi)를 이용해 기존에 보고된 Varroa destructor 서열(GenBank no. NC_004454.2)과 비교하였다. 이후 MEGA X software (Kumar et al., 2018)에서 ATP6-COX3 염기서열을 무척추동물 미토콘드리아 유전부호(invertebrate mitochondrial genetic code)를 적용해 번역하였으며, 번역된 아미노산 서열을 V. destructor 참조서열 (NP_758878.1)과 비교해 변이를 확인하였다.

다중 서열 정렬 및 계통분석은 MEGA X software (Kumar et al., 2018)를 사용해 수행하였다. 계통분석은 neighbor-joining (NJ) 방법으로 bootstrap을 1,000회 반복하여 신뢰도를 평가하였다. Haplotype network 분석은 TCS 방법 (Clement et al., 2000)을 기반으로 수행하였으며, PopART software (Leigh and Bryant, 2015)를 이용해 시각화하였다. 분석에는 GenBank에 등록된 V. destructor K-type 서열 (GenBank no. AJ493124.2, AP019523.1)과 함께 V. jacobsoni COI (MF462134) 및 ATP6-COX3 (GQ387676, GQ387874), V. underwoodi COI (AF107260) 및 ATP6-COX3 (MH205188, MH205199) 서열을 포함하였다.

4. 통계분석

통계분석은 R studio (R Foundation for statistical Computing, Vienna, Austria)를 사용하여 수행하였다. 정규분포를 따르고 등분산성을 만족하는 3개 이상의 그룹을 비교하기 위해 One-Way ANOVA test를 수행하였으며 이후 Tukey’s HSD로 유의성을 검정하였다.


결 과

1. 꿀벌응애 형태 분석

재래꿀벌(AcV 1, 2 및 3)과 양봉꿀벌(AmVd)에서 검출된 응애를 현미경으로 관찰하였다(Fig. 1). 개체별로 촬영된 등면 및 배면 사진(Fig. 1B)을 활용하여 형태를 측정하였다(Table 2). 체장은 1.142~1.159 mm 범위였으며, 체폭은 1.659~1.699 mm 범위로 나타났다. 생식기덮개 길이 및 너비는 각각 0.573~0.583 mm, 0.673~0.740 mm 범위를 보였고, 항문덮개 길이 및 너비는 0.263~0.265 mm, 0.121~0.124 mm 범위였다. 모든 개체는 기존 문헌에 보고된 꿀벌응애의 형태적 진단 범위에 포함되었으며(Anderson and Trueman, 2000; Rosenkranz et al., 2010), 6개 형태 지표 모두에서 그룹 간(AmVd, AcV-1, 2 및 3) 유의적 차이는 관찰되지 않았다(One-way ANOVA following Tukey’s HSD, P>0.05).

Fig. 1.

Morphological characteristics and measurement scheme of V. destructor. (A) Adult female mites collected from A. cerana (left) and A. mellifera (right). (B) Representative dorsal (left) and ventral (right) views of an adult female Varroa mite used for morphometric analysis. Body length (BL) and body width (BW) were measured from the dorsal view. Genital shield length (GSL) and width (GSW), and anal shield length (ASL) and width (ASW) were measured from the ventral view. Scale bars, 1 mm.

Morphometric characteristics of Varroa destructor collected from different honeybee groups (mean±SD, mm)

2. mtDNA 증폭 및 전기영동

COI 유전자(376 bp) 및 ATP6-COX3 (818 bp) 영역을 대상으로 각 그룹 5개체씩 PCR을 수행하였다. 정제된 PCR 산물 전기영동 결과 모든 시료에서 예상 크기의 단일 증폭 밴드가 확인되었으며, 그룹 간 밴드 위치 및 이동 양상에서 차이는 확인되지 않았다(Fig. 2).

Fig. 2.

Gel electrophoresis of purified PCR products amplified from V. destructor. Each lane represents a single mite individual. (A) Amplifi- cation of the partial mtDNA cytochrome oxidase I (COI). (B) Amplification of the partial mtDNA ATP synthase subunit 6-cytochrome c oxidase subunit 3 region (ATP6-COX3). M, DNA size marker; AmVd, mites collected from A. mellifera colony; AcV-1, 2, and 3, mites collected from A. cerana colonies.

3. mtDNA 염기서열 및 계통분석

COIATP6-COX3 영역의 PCR 산물에 대해 염기서열을 분석하였다. GenBank에 등록된 V. destructor의 참조서열(GenBank no. NC_004454.2)과 비교한 결과 COI 유전자는 100%의 염기서열 일치를 나타내 이후 분석에는 대표서열 1개만을 사용하였다. 반면 ATP6-COX3 영역에서는 참조서열 대비 일부 염기 치환이 관찰되었으며, 각 그룹에서 분석된 5개 시료 간 비교에서도 일부 염기서열 변이가 확인되었다. 전체 염기서열 유사도는 99.25~99.55% 범위로 나타났다(Table 3). ATP6-COX3 영역에서의 염기 변이 분석 결과 모든 시료에서 409번 위치의 C → T 치환이 공통적으로 확인되었으며, 461-462번 위치에서도 참조서열과 다른 염기 양상이 일관되게 나타났다(TC → CT). 또한 AcV-2 시료에서는 511번 염기의 G → A 치환 개체가 확인되었으나 AmVd, AcV-1, 3 시료에서는 이러한 변이가 관찰되지 않았다. 649번 위치에서는 AmVd와 AcV-2에서 T→A 치환이 확인되었으며, AcV-1과 AcV-3에서는 각각 T/A 형태의 집단 내 변이가 관찰되었다. 이후 분석에서 동일 봉군 내 서로 다른 서열은 a와 b로 표기하였다. 이러한 염기서열 변이는 COX3 영역에만 집중되어 분포하였으며, 염기서열 변이에 따른 COX3 단백질 내 아미노산 변이도 함께 확인되었다(Table 4).

Sequence identity and variable nucleotide sites in mitochondrial DNA of Varroa destructor

Variable amino acid sites in the mitochondrial COX3 region of Varroa destructor

이후 Korean haplotype (K-type) V. destructor(GenBank no. AJ493124.2, K1; AP019523.1, K2), V. jacobsoni, V. underwoodi의 mtDNA sequence와 다중 서열 정렬을 수행해 염기서열 차이를 조사하였다. 마찬가지로 시료의 COI 유전자는 K-type과 동일한 염기서열을 보였으며(Fig. 3A), 염기서열을 이용한 계통수 분석 결과 역시 모든 시료가 V. jacobsoniV. underwoodi와 명확히 구분되며 대표적인 K-type 서열(K1, K2)과 함께 단일 계통군을 형성하였다(Fig. 3B). ATP6-COX3 영역을 기반으로 한 다중 서열 정렬 결과 대부분의 시료는 K-type 서열(K1, K2)과 높은 유사성을 보였으며, 일부 위치에서 염기 치환이 확인되었다(Fig. 4A). 계통수 분석 결과 모든 시료는 K-type 서열과 동일한 계통군을 형성하며 다른 Varroa종과 명확히 분리되었다. 다만 계통군 내부에서는 소규모 분화가 관찰되었다. AcV-1b, AcV-2b, AcV-3a 및 AmVd는 하나의 소집단을 형성한 반면, AcV-1a 및 AcV-3b는 K2와 집단을 형성하였다. 또한 AcV-2a는 동일 계통군 내에서 약간 분리된 위치를 보였다(Fig. 4B). Haplotype network 분석에서도 유사한 경향이 확인되었다(Fig. 4C). 대부분의 시료(AmVd, AcV-1b, AcV-2b, AcV-3a)는 하나의 주요 haplotype을 형성하였으며, AcV-2a는 이로부터 단일 염기 변이로 분리된 haplotype으로 나타났다. 반면 K2 haplotype에는 AcV-1a 및 AcV-3b가 포함되었고, K1은 K2와 소수의 변이 단계 차이를 보였다. 전체적으로 haplotype 간 변이 단계가 적고 대부분의 시료가 제한된 haplotype에 포함되어 낮은 유전적 다양성을 나타내었다. Haplotype network 분석 결과 구분된 3개의 그룹으로부터 대표 서열로 AcV-1b, AcV-2a 및 AcV-3b를 선발하여 GenBank에 등록하였다(GenBank no. PZ206364-206366).

Fig. 3.

Multiple sequence alignment (A) and phylogenetic tree (B) based on partial mitochondrial COI sequences of Varroa mites collected from A. mellifera (AmVd) and A. cerana colonies (AcV-1, 2, and 3). Sequences were compared with Korean haplotypes K1 (AJ493124.2) and K2 (AP019523.1), together with sequences of V. jacobsoni (GenBank no. MF462134) and V. underwoodi (GenBank no. AF107260). Dots indicate nucleotide identity with the reference sequence, and nucleotide substitutions are shown as letters. Bootstrap values (%) are indicated at the nodes, and the scale bar represents the number of substitutions per site.

Fig. 4.

Sequence variation and phylogenetic relationships of Varroa mites based on the mitochondrial ATP6-COX3 region. (A) Multiple sequence alignment, (B) Phylogenetic tree, (C) Haplotype network. Sequences were obtained from mites collected from A. mellifera (AmVd) and A. cerana (AcV-1, 2, and 3), with intra-group variants indicated as a and b. Sequences were compared with Korean haplotypes K1 (AJ493124.2) and K2 (AP019523.1), together with sequences of V. jacobsoni (GQ387676, GQ387874) and V. underwoodi (MH205188, MH205199). Dots indicate nucleotide identity and substitutions are shown as letters. Bootstrap values (>50%) are shown at nodes. Circle size reflects haplotype frequency, and hatch marks indicate mutational steps.


고 찰

본 연구는 국내 재래꿀벌(Apis cerana)과 양봉꿀벌(A. mellifera) 봉군에서 채집된 응애를 대상으로 형태적 특성과 mtDNA 분석을 수행하여 두 기주로부터 검출된 꿀벌응애의 분류학적 동일성을 평가하였다. V. destructor는 지역적 환경, 기주 종 및 기후 조건에 따라 일정 수준의 형태적 변이를 보일 수 있는 것으로 알려져 있다(Akimov et al., 2004; Dadgostar and Nozari, 2018). 일부 연구에서는 서로 다른 지역이나 봉군에서 채집된 응애 개체의 체장 또는 생식기 구조 등에서 통계적으로 유의한 차이를 보고한 바 있으나(Maggi et al., 2009; Kelomey et al., 2016), 본 연구의 형태 측정 결과 몸 길이 및 너비, 생식기덮개 길이 및 너비, 항문덮개 길이 및 너비의 모든 형태 지표에서 그룹 간 유의한 차이는 확인되지 않았다. 본 연구에서 확인된 측정치는 기존 문헌에 보고된 Varroa destructor의 형태 측정 범위 내에 포함되는 값이다. 이러한 형태적 차이의 부재는 국내 응애 개체군 간 형태적 분화 수준이 크지 않거나, 재래꿀벌에서의 응애 발생이 비교적 최근의 현상으로 개체군 간 차이가 아직 뚜렷하게 나타나지 않았을 가능성이 있다. 이러한 점을 고려했을 때 각 숙주로부터 검출된 응애가 동일 종에 속할 것으로 추측할 수 있으나, 단순히 형태적 유사성만으로 두 개체군의 분류학적 동일성을 명확히 판단하기에는 한계가 있다. 더하여 기주 종이나 지역적 요인에 따른 haplotype의 차이가 발생할 가능성 또한 배제할 수 없어 이를 확인하기 위한 mtDNA 분석을 추가로 수행하였다.

mtDNA COI 유전자 및 ATP6-COX3 영역을 대상으로 한 염기서열 분석 결과 COI 유전자는 표준 참조 서열과 완벽히 일치했으며, ATP6-COX3 영역에서는 소수의 염기 변이(99.25~99.55%)가 관찰되었다. 이러한 염기서열 변이는 일부 아미노산 치환으로 이어졌으나, 이러한 변이가 기주 특이성이나 재래꿀벌 봉군 내 번식 가능한 개체군을 형성하는 데 직접적인 영향을 미치는지에 대해서는 명확하지 않다. COX3는 미토콘드리아 전자전달계에 관여하는 단백질로 알려져 있으나, 본 연구에서 확인된 아미노산 변이는 소수 위치에 국한되며 전체적으로 높은 서열 유사도가 유지된다는 점에서 기능적 영향은 제한적일 가능성이 있다.

다중 염기서열 및 계통수 분석 결과 모든 시료들은 대표적인 K-type 서열(K1, K2)과 매우 높은 일치도를 보이며 단일 계통군을 형성하였다. COI 유전자의 경우 모든 시료에서 일관되게 K-type과 동일한 염기서열을 보이며 다른 Varroa 종들과 명확히 분리되었다. 이는 동일 계통 내 COI 유전자의 분화가 크지 않음을 보여주며, COI 유전자가 Varroa 종 수준의 동정에는 효과적이나 동일한 종 내 미세한 유전적 변이를 구분하는 것은 제한적일 수 있다는 것을 나타낸다. 반면 ATP6-COX3 영역에서의 계통수 분석 결과는 COI 유전자에 비해 시료 간 분지 구조가 보다 구체적으로 나타났다. AcV-1b, AcV-2b, AcV-3a 및 AmVd는 하나의 소집단을 형성한 반면, AcV-1a 및 AcV-3b는 K2 (AP019523.1)와 동일한 위치에 배열되었다. 또한 AcV-2a는 동일 계통군 내에서 상대적으로 분리된 위치를 나타내어 단일 변이에 의해 구분되는 독립적인 변이형으로 확인되었다. Haplotype network 분석에서 역시 일관된 결과가 확인되었다. 전체적으로 haplotype 간 변이 단계가 제한적이며, 대부분의 시료가 소수의 haplotype에 집중되어 나타나는 양상은 국내 V. destructor 개체군의 낮은 유전적 다양성을 반영하는 것으로 해석된다. 다만 이러한 변이 양상은 기주 종에 따라 일관되게 구분되지 않았으며, 동일 봉군 내에서도 서로 다른 유전자형이 확인되었다. 이는 봉군 간 이동이나 외부 유입에 의해 서로 다른 유전적 배경을 가진 개체가 혼입되었을 가능성을 시사한다. 그럼에도 불구하고 본 연구에서 분석한 시료들이 전반적으로 유사한 유전자형을 유지하고 있다는 점, COI 유전자가 모든 시료에서 대표적인 K-type 서열들과 완전히 동일한 염기서열을 나타낸 점을 고려할 때, ATP6-COX3 영역에서 확인된 변이는 동일한 K-type 내에서 나타난 유전적 변이로 보는 것이 타당하다. 따라서 본 연구의 재래꿀벌 검출 응애는 양봉꿀벌 봉군에 기생하는 K-type V. destructor와 동일한 개체군에 속하는 것으로 판단된다. 한편 ATP6-COX3 영역에서 관찰된 염기서열 변이는 ATP6-COX3 영역이 COI에 비해 상대적으로 높은 변이 탐지율을 가질 가능성을 시사하며, 향후 지역 개체군 수준의 유전적 다양성 평가에 활용될 수 있을 것으로 보인다.

결론적으로 본 연구에서는 재래꿀벌 봉군에서 발견된 응애가 새로운 종이나 다른 haplotype의 V. destructor가 아닌 양봉꿀벌에 기생하는 K-type V. destructor와 동일한 haplotype이라는 것을 확인하였다. 특히 재래꿀벌 봉장이 양봉꿀벌 봉장과 근접한 거리에 위치하고 있었던 점을 고려했을 때, 해당 응애 개체군은 주변 양봉꿀벌 봉군으로부터 유입되었을 가능성이 매우 높은 것으로 사료된다. 이와 같은 현상은 양봉꿀벌 봉군에서 증식한 꿀벌응애가 주변 재래꿀벌 봉군으로 유입되는 기생충 역전파(parasite spillback) 현상으로 이해될 수 있다. 실제로 서로 다른 기주 종이 동일한 환경에서 공존할 경우 기생체가 기주 종 간에 전파되는 현상이 보고되어 있으며(Lymbery et al., 2014), 이러한 기주이전(host shift) 또는 기생충 역전파는 다양한 외부기생성 절지동물에서도 관찰된 바 있다(Obiegala et al., 2021). 특히 이동양봉과 같은 양봉 관리 방식은 봉군 간 접촉 가능성을 높여 기생충 확산을 촉진할 수 있는 요인으로 지목되어 왔다(Martínez-López et al., 2022). 본 연구 결과는 재래꿀벌 봉군에서도 꿀벌응애 유입 가능성을 고려한 관리 및 방제가 필요함을 시사하며, 특히 양봉꿀벌 봉군과 인접한 경우 지속적인 꿀벌응애 발생 모니터링과 함께 봉군 간 감염 확산을 최소화하기 위한 방제 시기 및 관리 전략이 요구될 수 있다. 다만 본 연구에서는 재래꿀벌 봉군에서 검출된 응애가 일시적인 감염에 그치는지, 혹은 재래꿀벌 봉군 내에서 번식 가능한 개체군으로 정착하고 있는지에 대해서는 확인하지 못하였다. 향후 다양한 지역의 재래꿀벌 봉군을 대상으로 응애 발생 및 번식 여부를 장기적으로 조사할 필요가 있을 것으로 생각된다.

Acknowledgments

본 연구는 농촌진흥청 연구과제 PJ01779802의 연구비 및 2026년 농촌진흥청 국립농업과학원 전문연구원 과정 지원 사업에 의해 수행되어 이에 감사드립니다.

References

  • Akimov, I. A., S. V. Benedyk and L. M. Zaloznaya. 2004. Complex analysis of morphological characters of gamasidmite Varroa destructor(Parasitiformes, Varroidae). Vestn. Zool. 38(5): 57-66.
  • Akinwande, K. L., M. A. Badejo and S. S. Ogbogu. 2012. Incidence of the Korean haplotype of Varroa destructor in southwest Nigeria. J. Apic. Res. 51(4): 369-370. [https://doi.org/10.3896/IBRA.1.51.4.15]
  • Anderson, D. L. and J. W. H. Trueman. 2000. Varroa jacobsoni (Acari: Varroidae) is more than one species. Exp. Appl. Acarol. 24: 165-189. [https://doi.org/10.1023/A:1006456720416]
  • Beaurepaire, A. L., A. Moro, F. Mondet, Y. Le Conte, P. Neumann and B. Locke. 2019. Population genetics of ectoparasitic mites suggest arms race with honeybee hosts. Sci. Rep. 9: 11355. [https://doi.org/10.1038/s41598-019-47801-5]
  • Boot, W. J., J. N. M. Calis and J. Beetsma. 1992. Differential periods of Varroa mite invasion into worker and drone cells of honey bees. Exp. Appl. Acarol. 16: 295-301. [https://doi.org/10.1007/BF01218571]
  • Choi, Y. S., M. L. Lee, H. S. Sim, H. K. Kim, G. H. Byeon, M. Y. Yoon, A. R. Kang, T. T. Van and S. O. Woo. 2014. Morphological analysis and determination of interference competition between two honey bee mites: Varroa destructor and Tropilaelaps clareae (Acari: Varroidae and Laelapidae). J. Apic. 29(4): 327-332. [https://doi.org/10.17519/apiculture.2014.11.29.4.327]
  • Clement, M., D. Posada and K. A. Crandall. 2000. TCS: A computer program to estimate gene genealogies. Mol. Ecol. 9(10): 1657-1659. [https://doi.org/10.1046/j.1365-294x.2000.01020.x]
  • Cox-Foster, D. L., S. Conlan, E. C. Holmes, G. Palacios, J. D. Evans, N. A. Moran, P. L. Quan, T. Briese, M. Horing, D. M. Geiser, V. Martinson, D. vanEngelsdorp, A. L. Kalkstein, A. Drysdale, J. Hui, J. Zhai, L. Cui, S. K. Hutchison, J. F. Simons, M. Egholm, J. S. Pettis and W. I. Lipkin. 2007. A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318: 283-287. [https://doi.org/10.1126/science.1146498]
  • Dadgostar, S. and J. Nozari. 2018. Classical and geometric morphometric methods reveal differences between specimens of Varroa destructor (Mesostigmata: Varroidae) from seven provinces of Iran. Pers. J. Acarol. 7(1): 51-60.
  • Grindrod, I. and S. J. Martin. 2023. Varroa resistance in Apis cerana: A review. Apidologie 54: 14. [https://doi.org/10.1007/s13592-022-00977-8]
  • Ji, T., L. Yin, Z. Liu, Q. Liang, Y. Luo, J. Shen and F. Shen. 2014. Transcriptional responses in eastern honeybees (Apis cerana) infected with mites, Varroa destructor. Genet. Mol. Res. 13(4): 8888-8900. [https://doi.org/10.4238/2014.October.31.4]
  • Kang, S. W., M. S. Yoo, J. H. Noh, H. S. Park, I. Min, D. M. Jeon, S. C. Park, M. S. Lee, Y. U. Hong, S. Y. Bang, E. H. Jang, M. K. Lee, J. S. Park, M. H. Jeong, K. Jung, M. S. Park, M. H. Yi, M. S. Kang, S. G. Kim, H. J. Seo, T. N. Jung, I. O. Ouh, Y. T. Kim, S. J. Han, S. W. Yun, S. Y. Cho, J. Y. Han, J. T. Kim, S. J. Lee, E. K. Shin, R. Chang, S. Kang, J. Ryu, H. S. Son, S. C. Jung and K. Y. Chang. 2012. Occurrence and prevalence of honeybee disease in Apis mellifera and Apis cerana in Korea. J. Apic. 27(3): 187-195.
  • Kelomey, E. A., P. Armand, A. Francois, G. Charlemagne, G. Georg, T. Manuele and B. M. Lamine. 2016. Morphometric characterization of parasite Varroa sp. of Bee Apis mellifera L. in Benin. Eur. Sci. J. 12(33): 221. [https://doi.org/10.19044/esj.2016.v12n33p221]
  • Kesik, H. K., S. G. Kilinc, F. Celik, A. Gul and S. Simsek. 2025. A preliminary study on the molecular variabilities in Varroa destructor and its effect on the body measurements. Vet. Res. Commun. 49: 55. [https://doi.org/10.1007/s11259-024-10619-2]
  • Kim, D. and C. Jung. 2008. Evaluation of chemical susceptibility of the ectoparasitic mite Varroa destructor in honey bee (Apis mellifera L.) J. Apic. 23: 261-268.
  • Kim, H. K. 2022. The effect of honey bee mites on the winter colony losses. J. Apic. 37(3): 291-299. [https://doi.org/10.17519/apiculture.2022.09.37.3.291]
  • Kim, M., B. H. Kim, S. Kim, T. A. Tai, J. M. Kim, S. Kim and B. S. Yoon, 2019. Development of ultra-rapid nested PCR method for detection of specific gene of Tracheal mite (Acarapis woodi) J. Apic. 34(1): 15-26. [https://doi.org/10.17519/apiculture.2019.04.34.1.15]
  • Kumar, S., G. Stecher, M. Li, C. Knyaz and K. Tamura. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35(6): 1547-1549. [https://doi.org/10.1093/molbev/msy096]
  • Leigh, J. W. and D. Bryant. 2015. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 6(9): 1110-1116. [https://doi.org/10.1111/2041-210X.12410]
  • Lin, Z., S. Wang, P. Neumann, G. Chen, P. Page, L. Li, F. Hu, H. Zheng and V. Dietemann. 2021. Population genetics and host specificity of Varroa destructor mites infesting eastern and western honeybees. J. Pest. Sci. 94(4): 1487-1504. [https://doi.org/10.1007/s10340-020-01322-7]
  • Lin, Z., Y. Qin, P. Page, S. Wang, L. Li, Z. Wen, F. Hu, P. Neumann, H. Zheng and V. Dietemann. 2018. Reproduction of parasitic mites Varroa destructor in original and new honeybee hosts. Ecol. Evol. 8(4): 2135-2145. [https://doi.org/10.1002/ece3.3802]
  • Lymbery, A. J., M. Morine, H. G. Kanani, S. J. Beatty and D. L. Morgan. 2014. Co-invaders: The effects of alien parasites on native hosts. Int. J. Parasitol. Parasites Wildl. 3(2): 171-177. [https://doi.org/10.1016/j.ijppaw.2014.04.002]
  • Maggi, M. D., N. H. Sardella, S. R. Ruffinengo and M. J. Eguaras. 2009. Morphotypes of Varroa destructor collected in Apis mellifera colonies from different geographic locations of Argentina. Parasitol. Res. 105: 1629-1636. [https://doi.org/10.1007/s00436-009-1605-8]
  • Martínez-López, V., C. Ruiz and P. De la Rúa. 2022. Migratory beekeeping and its influence on the prevalence and dispersal of pathogens to managed and wild bees. Int. J. Parasitol. Parasites Wildil. 18: 184-193. [https://doi.org/10.1016/j.ijppaw.2022.05.004]
  • Navajas, M., D. L. Anderson, L. I. de Guzman, Z. Y. Huang, J. Clement, T. Zhou and Y. Le Conte. 2010. New Asian types of Varroa destructor: A potential new threat for world apiculture. Apidologie 41: 181-193. [https://doi.org/10.1051/apido/2009068]
  • Obiegala, A., L. Arnold, M. Pfeffer, M. Kiefer, D. Kiefer, C. Sauter-Louis and C. Silaghi. 2021. Host-parasite interactions of rodent hosts and ectoparasite communities from different habitats in Germany. Parasit. Vectors 14: 112. [https://doi.org/10.1186/s13071-021-04615-7]
  • Oldroyd, B. P. 1999. Coevolution while you wait: Varroa jacobsoni, a new parasite of western honeybees. Trends Ecol. Evol. 14: 312-315. [https://doi.org/10.1016/S0169-5347(99)01613-4]
  • Park, Y. M. and M. L. Lee. 2004. Notes on the mitochondrial haplotype of Varroa destructor Anderson & Trueman (Acari: Varroidae) infested on honeybees in Korea and New Zealand. 2004. J. Apic. 19(2): 117-124.
  • Peng, Y. S., Y. Fang, S. Xu and L. Ge. 1987. The resistance mechanism of the Asian honeybee, Apis cerana Fabr., to an ectoparasitic mite, Varroa jacobsoni Oudemans. J. Invertebr. Pathol. 49: 54-60. [https://doi.org/10.1016/0022-2011(87)90125-X]
  • Rath, W. 1999. Co-adaptation of Apis cerana Fabr. and Varroa jacobsoni Oud. Apidologie 30: 2-3. [https://doi.org/10.1051/apido:19990202]
  • Rosenkranz, P., P. Aumeier and B. Ziegelmann. 2010. Biology and control of Varroa destructor. J. Invertebr. Pathol. 103: 96-119. [https://doi.org/10.1016/j.jip.2009.07.016]
  • Solignac, M., J. M. Cornuet, D. Vautrin, Y. Le Conte, D. Anderson, J. Evans, S. Cros-Arteil and M. Navajas. 2005. The invasive Korea and Japan types of Varroa destructor, ectoparasitic mites of the western honeybee (Apis mellifera), are two partly isolated clones. Proc. Biol. Sci. 272(1561): 411-419. [https://doi.org/10.1098/rspb.2004.2853]
  • van Alphen, J. J. M. and B. J. Fernhout. 2020. Natural selection, selective breeding, and the evolution of resistance of honeybees (Apis mellifera) against Varroa. Zool. Lett. 6: 6. [https://doi.org/10.1186/s40851-020-00158-4]

Fig. 1.

Fig. 1.
Morphological characteristics and measurement scheme of V. destructor. (A) Adult female mites collected from A. cerana (left) and A. mellifera (right). (B) Representative dorsal (left) and ventral (right) views of an adult female Varroa mite used for morphometric analysis. Body length (BL) and body width (BW) were measured from the dorsal view. Genital shield length (GSL) and width (GSW), and anal shield length (ASL) and width (ASW) were measured from the ventral view. Scale bars, 1 mm.

Fig. 2.

Fig. 2.
Gel electrophoresis of purified PCR products amplified from V. destructor. Each lane represents a single mite individual. (A) Amplifi- cation of the partial mtDNA cytochrome oxidase I (COI). (B) Amplification of the partial mtDNA ATP synthase subunit 6-cytochrome c oxidase subunit 3 region (ATP6-COX3). M, DNA size marker; AmVd, mites collected from A. mellifera colony; AcV-1, 2, and 3, mites collected from A. cerana colonies.

Fig. 3.

Fig. 3.
Multiple sequence alignment (A) and phylogenetic tree (B) based on partial mitochondrial COI sequences of Varroa mites collected from A. mellifera (AmVd) and A. cerana colonies (AcV-1, 2, and 3). Sequences were compared with Korean haplotypes K1 (AJ493124.2) and K2 (AP019523.1), together with sequences of V. jacobsoni (GenBank no. MF462134) and V. underwoodi (GenBank no. AF107260). Dots indicate nucleotide identity with the reference sequence, and nucleotide substitutions are shown as letters. Bootstrap values (%) are indicated at the nodes, and the scale bar represents the number of substitutions per site.

Fig. 4.

Fig. 4.
Sequence variation and phylogenetic relationships of Varroa mites based on the mitochondrial ATP6-COX3 region. (A) Multiple sequence alignment, (B) Phylogenetic tree, (C) Haplotype network. Sequences were obtained from mites collected from A. mellifera (AmVd) and A. cerana (AcV-1, 2, and 3), with intra-group variants indicated as a and b. Sequences were compared with Korean haplotypes K1 (AJ493124.2) and K2 (AP019523.1), together with sequences of V. jacobsoni (GQ387676, GQ387874) and V. underwoodi (MH205188, MH205199). Dots indicate nucleotide identity and substitutions are shown as letters. Bootstrap values (>50%) are shown at nodes. Circle size reflects haplotype frequency, and hatch marks indicate mutational steps.

Table 1.

Primer sequences used in this study

Genes Primer sequences Amplicon size (bp) Ref. of source
COI F: TACAAAGAGGGAAGAAGCAGCC 376 Solignac et al., 2005
R: GCCCCTATTCTTAATACATAGTGAAAATG
ATP6-COX3 F: GACATATATCAGTAACAATGAG 818
R: GACTCCAAGTAATAGTAAAACC

Table 2.

Morphometric characteristics of Varroa destructor collected from different honeybee groups (mean±SD, mm)

  Body length Body width Genital shield length Genital shield width Anal shield length Anal shield width
AmVd 1.155±0.032 1.670±0.054 0.583±0.017 0.673±0.016 0.263±0.009 0.121±0.004
AcV-1 1.142±0.028 1.699±0.038 0.573±0.024 0.740±0.019 0.263±0.011 0.124±0.006
AcV-2 1.159±0.025 1.659±0.113 0.582±0.019 0.731±0.019 0.265±0.014 0.121±0.007
AcV-3 1.147±0.029 1.695±0.047 0.576±0.022 0.730±0.030 0.264±0.011 0.122±0.006

Table 3.

Sequence identity and variable nucleotide sites in mitochondrial DNA of Varroa destructor

Group Sequence identities (%) Variable nucleotide positions
COI ATP6-COX3 409 461, 462 511 649
Variable nucleotide positions are numbered based on the full-length of ATP6-COX3 reference sequence.
AmVd: Apis mellifera Varroa destructor, AcV: A. cerana Varroa spp.
V. destructor ref.
(NC_004454.2)
- - C T C G T
AmVd 100 99.55 T C T G A
AcV-1 100 99.25~99.55 T C T G T/A
AcV-2 100 99.25~99.55 T C T A/G A
AcV-3 100 99.25~99.55 T C T G T/A

Table 4.

Variable amino acid sites in the mitochondrial COX3 region of Varroa destructor

Group/Sequence Variable amino acid positions in COX3
23 41 57 103
Amino acid positions are based on the COX3 coding sequence translated using the invertebrate mitochondrial genetic code.
AmVd: Apis mellifera Varroa destructor, AcV: A. cerana Varroa spp.
V. destructor ref.
(NP_758878.1)
Ser Leu Arg Met
AmVd Phe Phe Arg Lys
AcV-1 Phe Phe Arg Met/Lys
AcV-2 Phe Phe Gln/Arg Lys
AcV-3 Phe Phe Arg Met/Lys